ID: 951519472

View in Genome Browser
Species Human (GRCh38)
Location 3:23597984-23598006
Sequence GCAGGTAGGAAGTTTAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519472_951519479 26 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519479 3:23598033-23598055 TGCCCTGGACTACAAGATGTTGG No data
951519472_951519477 11 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519477 3:23598018-23598040 AGGACCTGGAGCTGCTGCCCTGG No data
951519472_951519474 -9 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519474 3:23597998-23598020 CCTACCTGCTGCTGAAATGCAGG No data
951519472_951519476 -3 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519476 3:23598004-23598026 TGCTGCTGAAATGCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519472 Original CRISPR GCAGGTAGGAAGTTTAACTC TGG (reversed) Intergenic
No off target data available for this crispr