ID: 951519474

View in Genome Browser
Species Human (GRCh38)
Location 3:23597998-23598020
Sequence CCTACCTGCTGCTGAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519472_951519474 -9 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519474 3:23597998-23598020 CCTACCTGCTGCTGAAATGCAGG No data
951519471_951519474 -4 Left 951519471 3:23597979-23598001 CCATACCAGAGTTAAACTTCCTA No data
Right 951519474 3:23597998-23598020 CCTACCTGCTGCTGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519474 Original CRISPR CCTACCTGCTGCTGAAATGC AGG Intergenic
No off target data available for this crispr