ID: 951519476

View in Genome Browser
Species Human (GRCh38)
Location 3:23598004-23598026
Sequence TGCTGCTGAAATGCAGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519471_951519476 2 Left 951519471 3:23597979-23598001 CCATACCAGAGTTAAACTTCCTA No data
Right 951519476 3:23598004-23598026 TGCTGCTGAAATGCAGGACCTGG No data
951519472_951519476 -3 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519476 3:23598004-23598026 TGCTGCTGAAATGCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519476 Original CRISPR TGCTGCTGAAATGCAGGACC TGG Intergenic
No off target data available for this crispr