ID: 951519477

View in Genome Browser
Species Human (GRCh38)
Location 3:23598018-23598040
Sequence AGGACCTGGAGCTGCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519473_951519477 -3 Left 951519473 3:23597998-23598020 CCTACCTGCTGCTGAAATGCAGG No data
Right 951519477 3:23598018-23598040 AGGACCTGGAGCTGCTGCCCTGG No data
951519475_951519477 -7 Left 951519475 3:23598002-23598024 CCTGCTGCTGAAATGCAGGACCT No data
Right 951519477 3:23598018-23598040 AGGACCTGGAGCTGCTGCCCTGG No data
951519471_951519477 16 Left 951519471 3:23597979-23598001 CCATACCAGAGTTAAACTTCCTA No data
Right 951519477 3:23598018-23598040 AGGACCTGGAGCTGCTGCCCTGG No data
951519472_951519477 11 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519477 3:23598018-23598040 AGGACCTGGAGCTGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519477 Original CRISPR AGGACCTGGAGCTGCTGCCC TGG Intergenic
No off target data available for this crispr