ID: 951519479

View in Genome Browser
Species Human (GRCh38)
Location 3:23598033-23598055
Sequence TGCCCTGGACTACAAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519475_951519479 8 Left 951519475 3:23598002-23598024 CCTGCTGCTGAAATGCAGGACCT No data
Right 951519479 3:23598033-23598055 TGCCCTGGACTACAAGATGTTGG No data
951519472_951519479 26 Left 951519472 3:23597984-23598006 CCAGAGTTAAACTTCCTACCTGC No data
Right 951519479 3:23598033-23598055 TGCCCTGGACTACAAGATGTTGG No data
951519473_951519479 12 Left 951519473 3:23597998-23598020 CCTACCTGCTGCTGAAATGCAGG No data
Right 951519479 3:23598033-23598055 TGCCCTGGACTACAAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519479 Original CRISPR TGCCCTGGACTACAAGATGT TGG Intergenic
No off target data available for this crispr