ID: 951519749

View in Genome Browser
Species Human (GRCh38)
Location 3:23600247-23600269
Sequence CAGAGTAATGGGAAGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519749_951519756 27 Left 951519749 3:23600247-23600269 CCTTACACCTTCCCATTACTCTG No data
Right 951519756 3:23600297-23600319 ATGTACAAACAGGTGCACGTGGG No data
951519749_951519754 17 Left 951519749 3:23600247-23600269 CCTTACACCTTCCCATTACTCTG No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519749_951519755 26 Left 951519749 3:23600247-23600269 CCTTACACCTTCCCATTACTCTG No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519749 Original CRISPR CAGAGTAATGGGAAGGTGTA AGG (reversed) Intergenic
No off target data available for this crispr