ID: 951519750

View in Genome Browser
Species Human (GRCh38)
Location 3:23600254-23600276
Sequence CTTTTTACAGAGTAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519750_951519754 10 Left 951519750 3:23600254-23600276 CCTTCCCATTACTCTGTAAAAAG No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519750_951519756 20 Left 951519750 3:23600254-23600276 CCTTCCCATTACTCTGTAAAAAG No data
Right 951519756 3:23600297-23600319 ATGTACAAACAGGTGCACGTGGG No data
951519750_951519755 19 Left 951519750 3:23600254-23600276 CCTTCCCATTACTCTGTAAAAAG No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519750 Original CRISPR CTTTTTACAGAGTAATGGGA AGG (reversed) Intergenic
No off target data available for this crispr