ID: 951519752

View in Genome Browser
Species Human (GRCh38)
Location 3:23600259-23600281
Sequence AGGATCTTTTTACAGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519752_951519756 15 Left 951519752 3:23600259-23600281 CCATTACTCTGTAAAAAGATCCT No data
Right 951519756 3:23600297-23600319 ATGTACAAACAGGTGCACGTGGG No data
951519752_951519754 5 Left 951519752 3:23600259-23600281 CCATTACTCTGTAAAAAGATCCT No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519752_951519755 14 Left 951519752 3:23600259-23600281 CCATTACTCTGTAAAAAGATCCT No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519752 Original CRISPR AGGATCTTTTTACAGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr