ID: 951519753

View in Genome Browser
Species Human (GRCh38)
Location 3:23600279-23600301
Sequence TACATATGATCACAACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519753_951519756 -5 Left 951519753 3:23600279-23600301 CCTCTTAGTTGTGATCATATGTA No data
Right 951519756 3:23600297-23600319 ATGTACAAACAGGTGCACGTGGG No data
951519753_951519758 21 Left 951519753 3:23600279-23600301 CCTCTTAGTTGTGATCATATGTA No data
Right 951519758 3:23600323-23600345 GCACACACATTCCATAGTTCTGG No data
951519753_951519755 -6 Left 951519753 3:23600279-23600301 CCTCTTAGTTGTGATCATATGTA No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519753 Original CRISPR TACATATGATCACAACTAAG AGG (reversed) Intergenic
No off target data available for this crispr