ID: 951519754

View in Genome Browser
Species Human (GRCh38)
Location 3:23600287-23600309
Sequence TTGTGATCATATGTACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519746_951519754 27 Left 951519746 3:23600237-23600259 CCAGACCCTTCCTTACACCTTCC No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519751_951519754 6 Left 951519751 3:23600258-23600280 CCCATTACTCTGTAAAAAGATCC No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519750_951519754 10 Left 951519750 3:23600254-23600276 CCTTCCCATTACTCTGTAAAAAG No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519748_951519754 21 Left 951519748 3:23600243-23600265 CCTTCCTTACACCTTCCCATTAC No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519747_951519754 22 Left 951519747 3:23600242-23600264 CCCTTCCTTACACCTTCCCATTA No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519749_951519754 17 Left 951519749 3:23600247-23600269 CCTTACACCTTCCCATTACTCTG No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data
951519752_951519754 5 Left 951519752 3:23600259-23600281 CCATTACTCTGTAAAAAGATCCT No data
Right 951519754 3:23600287-23600309 TTGTGATCATATGTACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519754 Original CRISPR TTGTGATCATATGTACAAAC AGG Intergenic
No off target data available for this crispr