ID: 951519755

View in Genome Browser
Species Human (GRCh38)
Location 3:23600296-23600318
Sequence TATGTACAAACAGGTGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951519750_951519755 19 Left 951519750 3:23600254-23600276 CCTTCCCATTACTCTGTAAAAAG No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data
951519751_951519755 15 Left 951519751 3:23600258-23600280 CCCATTACTCTGTAAAAAGATCC No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data
951519752_951519755 14 Left 951519752 3:23600259-23600281 CCATTACTCTGTAAAAAGATCCT No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data
951519753_951519755 -6 Left 951519753 3:23600279-23600301 CCTCTTAGTTGTGATCATATGTA No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data
951519749_951519755 26 Left 951519749 3:23600247-23600269 CCTTACACCTTCCCATTACTCTG No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data
951519748_951519755 30 Left 951519748 3:23600243-23600265 CCTTCCTTACACCTTCCCATTAC No data
Right 951519755 3:23600296-23600318 TATGTACAAACAGGTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951519755 Original CRISPR TATGTACAAACAGGTGCACG TGG Intergenic
No off target data available for this crispr