ID: 951520071

View in Genome Browser
Species Human (GRCh38)
Location 3:23603142-23603164
Sequence GCTGAAGGCCAGACAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951520071_951520076 21 Left 951520071 3:23603142-23603164 CCTGGTGCTGTCTGGCCTTCAGC No data
Right 951520076 3:23603186-23603208 TTTATGAAATGTGATTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951520071 Original CRISPR GCTGAAGGCCAGACAGCACC AGG (reversed) Intergenic
No off target data available for this crispr