ID: 951520822

View in Genome Browser
Species Human (GRCh38)
Location 3:23609363-23609385
Sequence CCAGAGTCTGGACTTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951520822_951520835 25 Left 951520822 3:23609363-23609385 CCTCAGCAAAGTCCAGACTCTGG No data
Right 951520835 3:23609411-23609433 GATCTTCACCAGTGAAATTAGGG No data
951520822_951520836 30 Left 951520822 3:23609363-23609385 CCTCAGCAAAGTCCAGACTCTGG No data
Right 951520836 3:23609416-23609438 TCACCAGTGAAATTAGGGAGAGG No data
951520822_951520830 -4 Left 951520822 3:23609363-23609385 CCTCAGCAAAGTCCAGACTCTGG No data
Right 951520830 3:23609382-23609404 CTGGGGGCTCTGCAGGACAAGGG No data
951520822_951520829 -5 Left 951520822 3:23609363-23609385 CCTCAGCAAAGTCCAGACTCTGG No data
Right 951520829 3:23609381-23609403 TCTGGGGGCTCTGCAGGACAAGG No data
951520822_951520834 24 Left 951520822 3:23609363-23609385 CCTCAGCAAAGTCCAGACTCTGG No data
Right 951520834 3:23609410-23609432 GGATCTTCACCAGTGAAATTAGG No data
951520822_951520831 3 Left 951520822 3:23609363-23609385 CCTCAGCAAAGTCCAGACTCTGG No data
Right 951520831 3:23609389-23609411 CTCTGCAGGACAAGGGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951520822 Original CRISPR CCAGAGTCTGGACTTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr