ID: 951522543

View in Genome Browser
Species Human (GRCh38)
Location 3:23622700-23622722
Sequence CTCCCATCACAGAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951522538_951522543 18 Left 951522538 3:23622659-23622681 CCACTGTTTTTTTGTTTTTGTTT No data
Right 951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951522543 Original CRISPR CTCCCATCACAGAAGGGGCA AGG Intergenic
No off target data available for this crispr