ID: 951527716

View in Genome Browser
Species Human (GRCh38)
Location 3:23669825-23669847
Sequence TGCCATGGTAATACTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951527716_951527723 24 Left 951527716 3:23669825-23669847 CCATGCCCAGTATTACCATGGCA No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527716_951527722 23 Left 951527716 3:23669825-23669847 CCATGCCCAGTATTACCATGGCA No data
Right 951527722 3:23669871-23669893 ATTCTTTGTTTTTTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951527716 Original CRISPR TGCCATGGTAATACTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr