ID: 951527723

View in Genome Browser
Species Human (GRCh38)
Location 3:23669872-23669894
Sequence TTCTTTGTTTTTTGCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951527719_951527723 9 Left 951527719 3:23669840-23669862 CCATGGCACTCACAAAAACACCA No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527717_951527723 19 Left 951527717 3:23669830-23669852 CCCAGTATTACCATGGCACTCAC No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527718_951527723 18 Left 951527718 3:23669831-23669853 CCAGTATTACCATGGCACTCACA No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527712_951527723 30 Left 951527712 3:23669819-23669841 CCAGCCCCATGCCCAGTATTACC No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527713_951527723 26 Left 951527713 3:23669823-23669845 CCCCATGCCCAGTATTACCATGG No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527716_951527723 24 Left 951527716 3:23669825-23669847 CCATGCCCAGTATTACCATGGCA No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data
951527715_951527723 25 Left 951527715 3:23669824-23669846 CCCATGCCCAGTATTACCATGGC No data
Right 951527723 3:23669872-23669894 TTCTTTGTTTTTTGCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951527723 Original CRISPR TTCTTTGTTTTTTGCTGCCT GGG Intergenic
No off target data available for this crispr