ID: 951534653

View in Genome Browser
Species Human (GRCh38)
Location 3:23729713-23729735
Sequence GAAGTGGCTCTCTGCGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951534653_951534656 -8 Left 951534653 3:23729713-23729735 CCTCTACCGCAGAGAGCCACTTC No data
Right 951534656 3:23729728-23729750 GCCACTTCAACCAGGTGACAAGG No data
951534653_951534659 15 Left 951534653 3:23729713-23729735 CCTCTACCGCAGAGAGCCACTTC No data
Right 951534659 3:23729751-23729773 ACAGCAAGAGAAAAAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951534653 Original CRISPR GAAGTGGCTCTCTGCGGTAG AGG (reversed) Intergenic
No off target data available for this crispr