ID: 951537209

View in Genome Browser
Species Human (GRCh38)
Location 3:23751025-23751047
Sequence GTGTGGGTAGGGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951537209_951537221 29 Left 951537209 3:23751025-23751047 CCTTCCTCTCTCCCTACCCACAC No data
Right 951537221 3:23751077-23751099 AGTTTCCACAGCCTCCGAACCGG No data
951537209_951537217 4 Left 951537209 3:23751025-23751047 CCTTCCTCTCTCCCTACCCACAC No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951537209 Original CRISPR GTGTGGGTAGGGAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr