ID: 951537217

View in Genome Browser
Species Human (GRCh38)
Location 3:23751052-23751074
Sequence ATCAGCCCTTAGCTCATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951537210_951537217 0 Left 951537210 3:23751029-23751051 CCTCTCTCCCTACCCACACCCGA No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537212_951537217 -8 Left 951537212 3:23751037-23751059 CCTACCCACACCCGAATCAGCCC No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537209_951537217 4 Left 951537209 3:23751025-23751047 CCTTCCTCTCTCCCTACCCACAC No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537205_951537217 16 Left 951537205 3:23751013-23751035 CCCATGACTGCCCCTTCCTCTCT No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537211_951537217 -7 Left 951537211 3:23751036-23751058 CCCTACCCACACCCGAATCAGCC No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537208_951537217 5 Left 951537208 3:23751024-23751046 CCCTTCCTCTCTCCCTACCCACA No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537206_951537217 15 Left 951537206 3:23751014-23751036 CCATGACTGCCCCTTCCTCTCTC No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data
951537207_951537217 6 Left 951537207 3:23751023-23751045 CCCCTTCCTCTCTCCCTACCCAC No data
Right 951537217 3:23751052-23751074 ATCAGCCCTTAGCTCATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951537217 Original CRISPR ATCAGCCCTTAGCTCATACC TGG Intergenic
No off target data available for this crispr