ID: 951544476

View in Genome Browser
Species Human (GRCh38)
Location 3:23810788-23810810
Sequence CACCCCGCGCGCGCCCCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951544476_951544485 -3 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544485 3:23810808-23810830 GTGGGGGCGGCGTGGCCGGGCGG 0: 1
1: 1
2: 6
3: 84
4: 831
951544476_951544493 28 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544493 3:23810839-23810861 CACCGCTGGGGAGCGACCTGCGG 0: 1
1: 0
2: 1
3: 8
4: 117
951544476_951544484 -6 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544484 3:23810805-23810827 GGGGTGGGGGCGGCGTGGCCGGG 0: 1
1: 0
2: 15
3: 163
4: 1385
951544476_951544488 14 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544488 3:23810825-23810847 GGGCGGTGGCAGCCCACCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 150
951544476_951544486 0 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544486 3:23810811-23810833 GGGGCGGCGTGGCCGGGCGGTGG 0: 1
1: 1
2: 21
3: 161
4: 1255
951544476_951544490 16 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544490 3:23810827-23810849 GCGGTGGCAGCCCACCGCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
951544476_951544483 -7 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544483 3:23810804-23810826 CGGGGTGGGGGCGGCGTGGCCGG 0: 1
1: 1
2: 13
3: 165
4: 1270
951544476_951544489 15 Left 951544476 3:23810788-23810810 CCGTCGGGGGCGCGCGCGGGGTG 0: 1
1: 0
2: 1
3: 20
4: 132
Right 951544489 3:23810826-23810848 GGCGGTGGCAGCCCACCGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951544476 Original CRISPR CACCCCGCGCGCGCCCCCGA CGG (reversed) Intronic