ID: 951544548

View in Genome Browser
Species Human (GRCh38)
Location 3:23811008-23811030
Sequence CGCCCTGCCGGGGTGGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951544531_951544548 28 Left 951544531 3:23810957-23810979 CCGGGCGGGTCGGGTGTTGAGCG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 951544548 3:23811008-23811030 CGCCCTGCCGGGGTGGGCATGGG 0: 1
1: 0
2: 0
3: 8
4: 179
951544540_951544548 -5 Left 951544540 3:23810990-23811012 CCTTCGGCCTGTCGGGGGCGCCC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 951544548 3:23811008-23811030 CGCCCTGCCGGGGTGGGCATGGG 0: 1
1: 0
2: 0
3: 8
4: 179
951544536_951544548 2 Left 951544536 3:23810983-23811005 CCTCGGACCTTCGGCCTGTCGGG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 951544548 3:23811008-23811030 CGCCCTGCCGGGGTGGGCATGGG 0: 1
1: 0
2: 0
3: 8
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951544548 Original CRISPR CGCCCTGCCGGGGTGGGCAT GGG Intronic
900314759 1:2051158-2051180 AGCCCTGCCGGGGGCTGCATTGG - Intronic
900656620 1:3761949-3761971 CCCCCTGCGAGGTTGGGCATGGG + Intronic
900925793 1:5705410-5705432 CTCCCTGTGGGGGTGGGCAGAGG + Intergenic
902816617 1:18919863-18919885 TGCCCAGCTGGGGTGGACATCGG - Intronic
903140184 1:21334651-21334673 CAGCCTTCCGGGGTGGGCTTGGG - Intronic
903289271 1:22297552-22297574 CTCTCTCCCGGGGTGGGGATGGG - Intergenic
903445646 1:23420985-23421007 GGTCCTGCCAGGGTGGGGATTGG - Intronic
905267525 1:36765051-36765073 AGCCCGGCAGGGGTGGGGATGGG + Intergenic
907440326 1:54474819-54474841 GGCCCAGCTGGGGTGGGCTTGGG + Intergenic
911039163 1:93578657-93578679 CGCCCTGCAGGGGAAGGCACAGG - Intronic
915161264 1:153922525-153922547 CGCCGTGCCGGGGTGGGGGGAGG + Intronic
915900539 1:159843559-159843581 TCCCCAGCAGGGGTGGGCATAGG - Intronic
918342971 1:183582300-183582322 GGCTCTGCTGGGCTGGGCATGGG + Intronic
919800387 1:201350564-201350586 TCTCCTGCTGGGGTGGGCATGGG + Intergenic
920534952 1:206731387-206731409 CACCCCGCAGGCGTGGGCATAGG - Intronic
921384214 1:214552485-214552507 CACCCTGCCTGGGTAGGCACTGG + Intergenic
922621888 1:226994887-226994909 CCCTCTGACGGGGAGGGCATGGG + Exonic
1062911823 10:1216611-1216633 CGGCCAGTCGGGGTGGCCATAGG - Intronic
1064712565 10:18141287-18141309 CTCCGAGCCGGGGTGGGCGTGGG + Intronic
1067229577 10:44397044-44397066 AGCCCGGCCAGGGAGGGCATAGG + Intergenic
1068615366 10:59108705-59108727 TGGGCTGCCGGGGTGTGCATTGG + Intergenic
1071086600 10:81874438-81874460 CGCCCTGCCCGGTTGAGCGTGGG - Intergenic
1076590965 10:131581764-131581786 GGACCTGCCGAGCTGGGCATGGG + Intergenic
1077046948 11:550976-550998 TACCCTGCAGGGGTGGGCTTGGG - Intronic
1077522300 11:3043562-3043584 CGGCCTGCTGGGGTGGGCACAGG - Intronic
1078055359 11:8004582-8004604 CTCTCTGCAGGGGTGGGCACAGG + Intergenic
1081663260 11:44901439-44901461 AGCTCTGCCTGGGTGGGCAGAGG + Intronic
1081670985 11:44942677-44942699 CTCCCTGCTAGGGTGGGCTTGGG - Intronic
1083170800 11:60923105-60923127 CGGGCTGCCGGGGTGGGCACTGG - Exonic
1083265696 11:61545963-61545985 TGCCCTGCCAGGGTGGACAGCGG - Intronic
1083667933 11:64285525-64285547 CGCCCGGCCGGGGGCGGCAACGG - Intronic
1083923669 11:65793516-65793538 CGGCCTGCTGGGGTGGGGGTGGG + Intronic
1084428121 11:69096672-69096694 CACCCTGCCGTGGTGGGCAAAGG - Intergenic
1085396815 11:76210555-76210577 CGCCCAGCCGGAGTGCGCACGGG - Intronic
1089712436 11:120325388-120325410 TGCCCGGCCGGGGTGGGCACGGG + Intronic
1090796953 11:130143353-130143375 CGCTCTTCTGGGGTGAGCATTGG - Exonic
1101009642 12:100436275-100436297 CTTCCTGTCAGGGTGGGCATAGG + Intergenic
1101806667 12:108069976-108069998 CGGCCAGCAGGGGAGGGCATGGG + Intergenic
1104763503 12:131312312-131312334 CGTCCTTCCGGGATGGGCAGAGG + Intergenic
1104815999 12:131645765-131645787 CGTCCTTCCGGGATGGGCAGAGG - Intergenic
1107133592 13:36920554-36920576 CGGCCTGCCGGGGTGGCCCGGGG + Intronic
1113373699 13:109744847-109744869 CGCCATGCAGCAGTGGGCATCGG + Intergenic
1113961913 13:114130947-114130969 CGCCTTGCCTGGGTGGGGAAAGG - Intronic
1121242326 14:92439781-92439803 CCCCCTGGCGGGGTGGGGGTGGG - Intronic
1122118160 14:99537804-99537826 CGCTTTGCTTGGGTGGGCATGGG - Intronic
1122512838 14:102283898-102283920 CTTCCAGCAGGGGTGGGCATGGG + Intronic
1122552470 14:102557371-102557393 TGCCCAGCCGTGGGGGGCATCGG + Intergenic
1125956169 15:43792568-43792590 CACCCTCCCGGGTTAGGCATAGG + Intronic
1128216245 15:65936219-65936241 AGCCCTGCCCTGGTGGGAATTGG + Intronic
1129220247 15:74128262-74128284 AGCCCTGCCCGGGCGGGCACTGG + Exonic
1130379643 15:83360378-83360400 CCAGCTCCCGGGGTGGGCATTGG + Intergenic
1132522394 16:397644-397666 CTCCCGGCCGGGGTGGGGGTGGG + Intronic
1132551628 16:556080-556102 AGCCTTCCCGGGGTGGGCAGTGG + Intergenic
1132759560 16:1502156-1502178 GGCCTTGCTGGGCTGGGCATGGG + Intronic
1132802815 16:1762656-1762678 CGCTCTGCAGGGGAGGGCACAGG - Exonic
1132903474 16:2270725-2270747 AGCCCTGCAGTGCTGGGCATGGG + Intergenic
1133025136 16:2985905-2985927 GGCCCTGCCTGGGTGGGTCTGGG + Intergenic
1137376586 16:47956900-47956922 CACCATGCTGGGGTGGGCAGGGG - Intergenic
1138599695 16:58047134-58047156 CACCCTGCCGGGGTGGGGCAGGG + Intergenic
1140410511 16:74738088-74738110 CCACCTGCCCGGGTGTGCATGGG - Intronic
1141127489 16:81411116-81411138 CTGCCTGCCGGGGTGGGGGTGGG - Intergenic
1141609760 16:85174730-85174752 CCCAGTGCCAGGGTGGGCATGGG + Intronic
1141767397 16:86067742-86067764 GGACCTGCCAGGGTGGGCAGTGG - Intergenic
1142762673 17:2051017-2051039 GGCCCCTCCGGGGTGGGGATGGG - Intergenic
1143682639 17:8488721-8488743 TGCTCTGCAGGGGTTGGCATGGG + Intronic
1146341167 17:32020939-32020961 CGGCCTGGCGGGGTGGGAAGGGG + Intronic
1146970095 17:37065599-37065621 CAGCCTGCTGGGGTGGGCACAGG - Intergenic
1147602729 17:41755982-41756004 GGCCCACCAGGGGTGGGCATGGG - Intronic
1148645595 17:49218164-49218186 CGCCCTGCCCCTGTGGGCACCGG + Intronic
1149441193 17:56675508-56675530 CGACCTGCTGGGGTGGCCAGAGG - Intergenic
1150292226 17:63988505-63988527 CTCCCTGCTGGGGTGGGCCGTGG - Intergenic
1152301530 17:79497805-79497827 GTCCCTGCTGGGGTGGCCATTGG - Intronic
1153977653 18:10283559-10283581 CCCCATGCCAGGGTGGGCAGTGG + Intergenic
1157419325 18:47531944-47531966 TGCCCAGCCAGGGTGGGCGTCGG + Intergenic
1158505558 18:58044062-58044084 CCCCGGGCCGGGGTGGGCGTGGG + Intergenic
1159390580 18:67787863-67787885 CTGCCTGCCAGGGTGGTCATGGG - Intergenic
1160507284 18:79434242-79434264 ATCCCTGCCGGGGTAGGCCTGGG + Intronic
1160858469 19:1227717-1227739 CGCCCTGCAGGGCCGGGCAGGGG + Exonic
1160860310 19:1234816-1234838 CACCCTGCCGGCCTGGGCAGGGG + Intronic
1160989328 19:1854123-1854145 CCCCCTCCCGGGGTGGGGTTTGG - Exonic
1161400744 19:4065565-4065587 CCCCCAGCCCGGGTGGGGATTGG - Intronic
1161415401 19:4144032-4144054 CACCCTACCGGGGTTGGCCTGGG - Intergenic
1161453516 19:4359395-4359417 CACCCTGCTGGGGTGGCCACGGG - Intronic
1161979435 19:7622890-7622912 GGGCCTGCCGGGGCGGGCAGAGG + Exonic
1162523955 19:11197037-11197059 CGTCCGGCCGGGCTGGGCCTGGG - Intronic
1162729805 19:12711517-12711539 CACCCAGCATGGGTGGGCATGGG - Intronic
1165924835 19:39320613-39320635 CGCCCTGCCCGTGTGGCCATCGG - Intergenic
1166014631 19:39970924-39970946 CGCCCTGCCGTGGAGGGCTGGGG - Intergenic
1166731464 19:45061343-45061365 CGCCCAGGCTGGGTGGCCATAGG + Intronic
1168636802 19:58002921-58002943 CGCCCTGCCTGGGCGGGGTTGGG + Exonic
938986541 2:136581822-136581844 CGCCCAGCTGGGGTGCTCATGGG - Intergenic
940152059 2:150613458-150613480 AGCCCTGCAGGGAAGGGCATGGG + Intergenic
942722178 2:178965638-178965660 GGCCCTGGTGGGGTGGGCACTGG - Intronic
946179888 2:217942834-217942856 CTCCCTGCAGGGGAGGGGATGGG - Intronic
946199784 2:218064876-218064898 CTCCCTGCAGGGGAGGGGATGGG - Intronic
948910690 2:241001031-241001053 CGCTCGGCCTGGGTGGGCGTGGG - Intronic
1172481106 20:35271845-35271867 GGCCGGGCCAGGGTGGGCATGGG + Intronic
1172628885 20:36365212-36365234 CACCCTGCCGTGCTGGGCACAGG + Intronic
1174342489 20:49906533-49906555 CGCCCTGCGGCGGCGGGCAGAGG - Exonic
1178855398 21:36246194-36246216 GGCCCTGCCGTGGTGGGCGGTGG - Exonic
1179609920 21:42543651-42543673 TTCCCTGCCTGGGTGGGCCTTGG + Intronic
1180159552 21:45992935-45992957 CTCCCTGACGGCGTGGGGATGGG - Intronic
1181430345 22:22877694-22877716 CAGCCTGCCAGGGAGGGCATGGG - Intronic
1181688070 22:24542950-24542972 GGCCCGGCTGGGGTGGGGATGGG + Exonic
1183392179 22:37552045-37552067 GGCCCTGCCTGGGTGGGCTGTGG - Intergenic
1183743593 22:39681104-39681126 GGTCCTGCCTGGGTGGGCAGGGG - Intronic
1184783799 22:46662212-46662234 CTCCCTGCCCGGGTGGCCTTGGG + Intronic
1185046405 22:48530747-48530769 CCCCCTGAAGGGGTGGGCCTGGG - Intronic
1185101266 22:48842112-48842134 TGCCCTGCGGGGGCTGGCATGGG + Intronic
1185330881 22:50251569-50251591 CGCCCGGGCCGGGTGGGCCTTGG - Intronic
951544548 3:23811008-23811030 CGCCCTGCCGGGGTGGGCATGGG + Intronic
953033197 3:39191129-39191151 GGACATGCCAGGGTGGGCATGGG - Intronic
953877849 3:46676614-46676636 AGCCCTGCTGGGGTGGCCAAGGG - Intronic
953907437 3:46875368-46875390 CTCCCTGGCAGTGTGGGCATGGG - Intronic
954544553 3:51421723-51421745 GGCACTGCTGGGGTGAGCATGGG - Intronic
961094200 3:124140786-124140808 TGCCCTCCCGGGGGGGGCACAGG + Intronic
961393419 3:126570095-126570117 CCCTCTGGCAGGGTGGGCATGGG + Intergenic
961453698 3:127014126-127014148 CGCCCCGGCGGGGTGGGCAGTGG + Intronic
961459933 3:127043831-127043853 CACCCTGCAGGGGAGGGCACTGG - Intergenic
961651414 3:128418422-128418444 GGCCTTGCTGGTGTGGGCATGGG - Intergenic
963939763 3:151086526-151086548 CGCCCAGCTGGGGTGGGTTTGGG + Intronic
966329317 3:178793509-178793531 CACCCTGGGGGGGTGGGCAATGG + Intronic
967857799 3:194131438-194131460 CGCCCTTCCGGGGCGGGGGTGGG + Intergenic
968589784 4:1451581-1451603 AGCCCTGCTGGGGTGGGCTCAGG + Intergenic
968601932 4:1513575-1513597 GGCCCTGCCGGGGTCAGCAGGGG - Intergenic
968628249 4:1637627-1637649 AGCCCGGCAGGGGTGGGCAGGGG + Intronic
968700942 4:2058275-2058297 CGCCCTGGTGGGGTGGGGAGGGG - Intergenic
968905305 4:3448060-3448082 CGCCCCGCCAGGGTGGACAGTGG + Intronic
975367304 4:73544476-73544498 GGCCCTGGTGGGGTGGGCACAGG - Intergenic
975994957 4:80303027-80303049 CGCCCTGCCAGGCAGGGCTTGGG + Intronic
977561398 4:98537116-98537138 GGCCCTGGTGGGGTGGGCACCGG + Intronic
980542893 4:134217431-134217453 CACCCTACCGGGGTGAGGATGGG + Intergenic
981093602 4:140756832-140756854 CTCCCTGCTGGGATGGGCGTCGG - Intergenic
985520992 5:373834-373856 CGCCCTGCCCGGGCGGGCGGGGG + Intronic
985551602 5:535953-535975 CGCCCTGCCCAGGTGGGCTGCGG - Intergenic
985688382 5:1294100-1294122 CGTCCTGCCCGGGTGGGCCCAGG + Exonic
988956278 5:36323671-36323693 CGCCCTGTGGTGGTGGCCATAGG - Intergenic
989431783 5:41364071-41364093 CCTCCTCCAGGGGTGGGCATGGG + Intronic
991594445 5:68288481-68288503 CGCACTGCCGGGCGGGGCGTGGG + Intronic
995146994 5:108797456-108797478 CTCCCTTCCTGGGTGGGCATTGG + Intronic
998406203 5:141876185-141876207 GGCGCTGCCGGGGTGGGGGTGGG - Intronic
1002164976 5:177338442-177338464 GGCCCTGTGGGGGTGGGCACGGG - Intronic
1002167900 5:177359427-177359449 TGCCCTCCCAGGGTGGGCCTGGG - Intronic
1003062846 6:2876123-2876145 CGGGCGGCCGGGGTGGGCAGGGG + Intergenic
1003523979 6:6883206-6883228 CTCCCTGCAGGTGTGGCCATTGG - Intergenic
1004272793 6:14210728-14210750 GGCCGTGGCGGGGTGCGCATTGG - Intergenic
1004911700 6:20291904-20291926 CACCCTTCCGGTGTGGGCTTAGG - Intergenic
1006339311 6:33437950-33437972 CGCCCAGCCAGGGTGGCCACTGG - Exonic
1006452152 6:34111578-34111600 TCCCCTGCCGGGGTGTGGATGGG - Intronic
1006456254 6:34133559-34133581 CCCACGGCCTGGGTGGGCATGGG + Exonic
1010703261 6:79077614-79077636 CGCCCTGCCGGCGGCGGCAGCGG + Intronic
1011033103 6:82943900-82943922 CTCCCTGCTTGTGTGGGCATCGG - Intronic
1016438802 6:144063780-144063802 CGCCCCGCCACGGTGGGCGTGGG - Intronic
1018894666 6:168005388-168005410 TGCCCTGCGGGGTTGGGCAGAGG + Intronic
1019351452 7:555993-556015 CGCACTGCTGGGATGAGCATAGG - Intronic
1019516563 7:1442715-1442737 TGCCTTGCCAGGGTGGTCATTGG - Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1021558474 7:21945606-21945628 CGCCCTGCAGGTGTGCGCAGTGG - Intronic
1022028695 7:26471843-26471865 CGCCCTGCCTGGCTGGGTACTGG - Intergenic
1023864844 7:44233752-44233774 CTCCCTGCCGGGGAGGGGAGGGG - Intronic
1024262444 7:47582292-47582314 CGCCCTGCCGAGGTGCGCCCTGG + Intronic
1025149744 7:56539140-56539162 AGCTTTGCAGGGGTGGGCATGGG + Intergenic
1027220049 7:76208163-76208185 ATCCCTGGCGGGGTGGGCTTAGG + Intronic
1028126330 7:87116935-87116957 CGCCCTTCAGGGGTGGTCAGAGG - Intergenic
1034957369 7:155343494-155343516 CCCCCTGGCAGTGTGGGCATTGG - Intergenic
1035096731 7:156361900-156361922 CTCCTTGCCGGGGTGAGCAGGGG - Intergenic
1035157220 7:156924028-156924050 CGCCATGACGGGTTGGGAATTGG + Intergenic
1035352727 7:158257846-158257868 AGCCCAGCAGGGGAGGGCATGGG - Intronic
1037876747 8:22552282-22552304 GGCTCTGCTGGGGTGGGCACTGG - Intronic
1048969787 8:139639023-139639045 CGGCCTGGCGGTGTGGGCCTGGG - Intronic
1049224045 8:141441254-141441276 GGCCCTGCAGGGGTGGGCCTGGG + Intergenic
1049628238 8:143636265-143636287 CGCCCTAGCGGGGCGGGCAGCGG - Intronic
1050204431 9:3181835-3181857 CGCTCTGCGGGTGTGGGCGTCGG + Intergenic
1050463372 9:5895785-5895807 CGCCCTGCCAAGCTGGGCAGTGG + Intronic
1051528645 9:18075710-18075732 AGCCCTCCCAGGGTGGGCTTGGG - Intergenic
1052883817 9:33624080-33624102 CGGCCTGCCTGGGTGGGGAGTGG - Intergenic
1053363217 9:37504272-37504294 CACACTGCCGGGGTTGCCATCGG + Intergenic
1056776490 9:89516608-89516630 CTGACTGCGGGGGTGGGCATGGG + Intergenic
1057314481 9:93959592-93959614 CGCCCTGTCCGGGTGGGCTGCGG + Intergenic
1058309529 9:103483943-103483965 CTCCCTGCCGGGCAGGGCTTGGG + Intergenic
1062111085 9:134782522-134782544 GGCCCGGACGGGGTGGGCTTGGG - Intronic
1189976199 X:46463121-46463143 CAGCCTGCAGGGGTGGGCCTAGG + Intronic
1189982867 X:46528500-46528522 CAGCCTGCAGGGGTGGGCCTAGG - Intronic
1192147345 X:68690415-68690437 CGCCCTGCCTGCCTGGGAATGGG - Intronic
1192614734 X:72608040-72608062 TGCCCAGCCGTGGTGGGTATAGG - Intronic
1193170717 X:78332557-78332579 CGCCCTGGGTTGGTGGGCATGGG + Intergenic
1198072050 X:133159073-133159095 GGCCCTGGTGGGGTGGGCACGGG - Intergenic
1198259143 X:134950785-134950807 GGCCCTGGTGGGGTGGGCACCGG - Intergenic