ID: 951544929

View in Genome Browser
Species Human (GRCh38)
Location 3:23815223-23815245
Sequence CTCTGGAAGGGCAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37698
Summary {0: 2, 1: 9, 2: 199, 3: 3838, 4: 33650}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951544929_951544936 -8 Left 951544929 3:23815223-23815245 CCACCCACTTTGCCCTTCCAGAG 0: 2
1: 9
2: 199
3: 3838
4: 33650
Right 951544936 3:23815238-23815260 TTCCAGAGTGCTGGGATTACAGG 0: 316
1: 17802
2: 310705
3: 259932
4: 145685
951544929_951544938 4 Left 951544929 3:23815223-23815245 CCACCCACTTTGCCCTTCCAGAG 0: 2
1: 9
2: 199
3: 3838
4: 33650
Right 951544938 3:23815250-23815272 GGGATTACAGGCGTGAGCCATGG 0: 2406
1: 5503
2: 4826
3: 2918
4: 1749
951544929_951544939 11 Left 951544929 3:23815223-23815245 CCACCCACTTTGCCCTTCCAGAG 0: 2
1: 9
2: 199
3: 3838
4: 33650
Right 951544939 3:23815257-23815279 CAGGCGTGAGCCATGGTGCCTGG 0: 110
1: 1488
2: 23813
3: 94927
4: 138180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951544929 Original CRISPR CTCTGGAAGGGCAAAGTGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr