ID: 951544929 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:23815223-23815245 |
Sequence | CTCTGGAAGGGCAAAGTGGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 37698 | |||
Summary | {0: 2, 1: 9, 2: 199, 3: 3838, 4: 33650} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
951544929_951544936 | -8 | Left | 951544929 | 3:23815223-23815245 | CCACCCACTTTGCCCTTCCAGAG | 0: 2 1: 9 2: 199 3: 3838 4: 33650 |
||
Right | 951544936 | 3:23815238-23815260 | TTCCAGAGTGCTGGGATTACAGG | 0: 316 1: 17802 2: 310705 3: 259932 4: 145685 |
||||
951544929_951544938 | 4 | Left | 951544929 | 3:23815223-23815245 | CCACCCACTTTGCCCTTCCAGAG | 0: 2 1: 9 2: 199 3: 3838 4: 33650 |
||
Right | 951544938 | 3:23815250-23815272 | GGGATTACAGGCGTGAGCCATGG | 0: 2406 1: 5503 2: 4826 3: 2918 4: 1749 |
||||
951544929_951544939 | 11 | Left | 951544929 | 3:23815223-23815245 | CCACCCACTTTGCCCTTCCAGAG | 0: 2 1: 9 2: 199 3: 3838 4: 33650 |
||
Right | 951544939 | 3:23815257-23815279 | CAGGCGTGAGCCATGGTGCCTGG | 0: 110 1: 1488 2: 23813 3: 94927 4: 138180 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
951544929 | Original CRISPR | CTCTGGAAGGGCAAAGTGGG TGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |