ID: 951545388

View in Genome Browser
Species Human (GRCh38)
Location 3:23819642-23819664
Sequence TTAAACCATCCGACCAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951545388_951545394 25 Left 951545388 3:23819642-23819664 CCTAATTTGGTCGGATGGTTTAA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 951545394 3:23819690-23819712 GAAAATAGTGGAAATTGCTGGGG 0: 1
1: 0
2: 2
3: 24
4: 325
951545388_951545392 23 Left 951545388 3:23819642-23819664 CCTAATTTGGTCGGATGGTTTAA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 951545392 3:23819688-23819710 CAGAAAATAGTGGAAATTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 269
951545388_951545389 13 Left 951545388 3:23819642-23819664 CCTAATTTGGTCGGATGGTTTAA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 951545389 3:23819678-23819700 TTACCCTCTTCAGAAAATAGTGG 0: 1
1: 0
2: 0
3: 20
4: 197
951545388_951545393 24 Left 951545388 3:23819642-23819664 CCTAATTTGGTCGGATGGTTTAA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 951545393 3:23819689-23819711 AGAAAATAGTGGAAATTGCTGGG 0: 1
1: 0
2: 2
3: 40
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951545388 Original CRISPR TTAAACCATCCGACCAAATT AGG (reversed) Intronic
910399372 1:86823385-86823407 TTAAACCATCCATCCAAAATTGG - Intergenic
911337897 1:96603308-96603330 TTAAATTATCCCAACAAATTAGG + Intergenic
918611073 1:186492899-186492921 TTTAAGCATCCGACCACGTTTGG - Intergenic
921817369 1:219579124-219579146 ATAGTCCATCAGACCAAATTAGG + Intergenic
1065750482 10:28881946-28881968 GTAAACCATCCTGCCACATTAGG - Intergenic
1075285807 10:121184713-121184735 TTAAAGAATCAGGCCAAATTTGG - Intergenic
1076596992 10:131629781-131629803 TTAAACCGTAGTACCAAATTAGG + Intergenic
1082900092 11:58239076-58239098 CTAAATAATCTGACCAAATTCGG - Intergenic
1090559923 11:127920802-127920824 TTAAAACATCCCCCCAAAATGGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1098713218 12:73793894-73793916 GTAAACCATCTGAAAAAATTAGG + Intergenic
1100017911 12:90034481-90034503 TTAAACCATTCCAAGAAATTAGG + Intergenic
1108368119 13:49738420-49738442 TTAAACCAACAGATCAATTTAGG + Intronic
1113010999 13:105765501-105765523 TTAAAACATCCTACCATTTTAGG - Intergenic
1113434596 13:110280649-110280671 TAAAACCAACACACCAAATTTGG - Intronic
1113437055 13:110301333-110301355 TTAAAGCATCCCACCATGTTTGG - Intronic
1128420919 15:67490994-67491016 TTAAGTCATCCTACCTAATTGGG + Intronic
1141856977 16:86689500-86689522 TTAAACCAAACGATCCAATTAGG + Intergenic
1153587037 18:6632940-6632962 TTCAACCTTCAGACCAAATCTGG - Intergenic
1154967007 18:21369059-21369081 TTAAAGCATCAGATGAAATTTGG + Intronic
1155952778 18:31931579-31931601 GTAAACCATCAGCCCAATTTTGG - Intronic
1157559461 18:48636451-48636473 CTCAACCATCAGACCCAATTTGG - Intronic
928146061 2:28776715-28776737 TTAAACCATGGGACCAAATAGGG + Intronic
928411155 2:31055044-31055066 TTAAACCATCTGAACAAAGGAGG + Intronic
929847681 2:45547434-45547456 TTAATCCCTCCCTCCAAATTAGG + Intronic
932901663 2:75708463-75708485 TTAAACCATATGATTAAATTTGG - Intronic
941311743 2:163941289-163941311 TTAGAACATTCTACCAAATTTGG + Intergenic
945386471 2:209208098-209208120 TTAAACCTTTTGACCACATTGGG + Intergenic
1184882180 22:47315325-47315347 TTTAACTATCTGAGCAAATTGGG + Intergenic
951108420 3:18772342-18772364 TTAAACCATTTGACAAAATTGGG + Intergenic
951545388 3:23819642-23819664 TTAAACCATCCGACCAAATTAGG - Intronic
953999880 3:47547681-47547703 TTAATGCATCTGACCAAGTTAGG + Intergenic
955284864 3:57630485-57630507 TTAAACCAGCCATCAAAATTTGG + Exonic
959774101 3:110135595-110135617 ATAAACTAACCAACCAAATTTGG - Intergenic
967443028 3:189531004-189531026 TTAAACCACTCGACCACCTTGGG + Intergenic
970689632 4:18607637-18607659 GTAAACCATCATACAAAATTTGG - Intergenic
973855607 4:55007508-55007530 TTAATCCCTCAGACTAAATTGGG + Intergenic
974619123 4:64333625-64333647 TTAAACCATCCTGCAAATTTAGG + Intronic
977602281 4:98946964-98946986 TTAAAACATCTGATCAAAATGGG - Intergenic
978172018 4:105683401-105683423 TTAAATCACACCACCAAATTAGG + Intronic
979870713 4:125816867-125816889 TTAAACCATTCCAGTAAATTTGG + Intergenic
986080157 5:4383106-4383128 TTAAACCCTCCCCCCAAATCTGG - Intergenic
988782767 5:34538386-34538408 TTAAATCCTCTGACCAGATTGGG - Intergenic
992142465 5:73812888-73812910 TTAAAACTTCCAACCACATTAGG + Intronic
995560982 5:113381490-113381512 TAAAACCATACGACCAAGCTCGG + Intronic
1005260855 6:24057802-24057824 TTATACCATCTGAACGAATTTGG - Intergenic
1010012871 6:71069398-71069420 TTAAACCATACCATCACATTTGG + Intergenic
1010380433 6:75217827-75217849 TTAAACCATCCTACACACTTTGG - Intergenic
1018138346 6:160801087-160801109 TTAAAACATTTGACCAAAATAGG - Intergenic
1043036000 8:75200338-75200360 TTGAACCATCCTTCCATATTTGG + Intergenic
1045537031 8:103040141-103040163 TTAAAGCATACAACCAAAATAGG - Intronic
1047059392 8:121207154-121207176 TAATACCTTCAGACCAAATTTGG - Intergenic
1055797457 9:79990432-79990454 TTAAACCTTCCAAGCAATTTTGG - Intergenic
1188890408 X:35605244-35605266 TTACCCCATCCGTCAAAATTAGG + Intergenic
1189063864 X:37785130-37785152 TTAAACCAACTGCCAAAATTGGG + Intronic
1194216047 X:91131496-91131518 TTAAACCATCCGATCTCATGAGG - Intergenic
1196274357 X:113749607-113749629 TTATACCATCCATCCAAGTTGGG + Intergenic
1197400694 X:125986331-125986353 TTAAACCATCTGATCAAAATTGG - Intergenic