ID: 951545589

View in Genome Browser
Species Human (GRCh38)
Location 3:23821755-23821777
Sequence CCCACCACACACGCGCCCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951545589_951545597 -1 Left 951545589 3:23821755-23821777 CCGTAGGGCGCGTGTGTGGTGGG 0: 1
1: 1
2: 0
3: 4
4: 93
Right 951545597 3:23821777-23821799 GTGGCAGGGGAGATGAGGGCAGG 0: 2
1: 0
2: 9
3: 102
4: 972
951545589_951545595 -6 Left 951545589 3:23821755-23821777 CCGTAGGGCGCGTGTGTGGTGGG 0: 1
1: 1
2: 0
3: 4
4: 93
Right 951545595 3:23821772-23821794 GGTGGGTGGCAGGGGAGATGAGG 0: 2
1: 3
2: 11
3: 138
4: 1306
951545589_951545600 20 Left 951545589 3:23821755-23821777 CCGTAGGGCGCGTGTGTGGTGGG 0: 1
1: 1
2: 0
3: 4
4: 93
Right 951545600 3:23821798-23821820 GGGTGGAAATGACTCCTTTTTGG 0: 2
1: 0
2: 2
3: 16
4: 134
951545589_951545599 3 Left 951545589 3:23821755-23821777 CCGTAGGGCGCGTGTGTGGTGGG 0: 1
1: 1
2: 0
3: 4
4: 93
Right 951545599 3:23821781-23821803 CAGGGGAGATGAGGGCAGGGTGG 0: 2
1: 2
2: 14
3: 168
4: 1397
951545589_951545596 -5 Left 951545589 3:23821755-23821777 CCGTAGGGCGCGTGTGTGGTGGG 0: 1
1: 1
2: 0
3: 4
4: 93
Right 951545596 3:23821773-23821795 GTGGGTGGCAGGGGAGATGAGGG 0: 2
1: 0
2: 11
3: 116
4: 1044
951545589_951545598 0 Left 951545589 3:23821755-23821777 CCGTAGGGCGCGTGTGTGGTGGG 0: 1
1: 1
2: 0
3: 4
4: 93
Right 951545598 3:23821778-23821800 TGGCAGGGGAGATGAGGGCAGGG 0: 2
1: 0
2: 9
3: 137
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951545589 Original CRISPR CCCACCACACACGCGCCCTA CGG (reversed) Intronic