ID: 951546363

View in Genome Browser
Species Human (GRCh38)
Location 3:23829974-23829996
Sequence AAGAAGGAGTGGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7920
Summary {0: 1, 1: 3, 2: 49, 3: 910, 4: 6957}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951546363_951546371 0 Left 951546363 3:23829974-23829996 CCCCCTTCCCTCCACTCCTTCTT 0: 1
1: 3
2: 49
3: 910
4: 6957
Right 951546371 3:23829997-23830019 ATTACCTAGCTAGCTACACCTGG 0: 1
1: 0
2: 0
3: 2
4: 46
951546363_951546373 8 Left 951546363 3:23829974-23829996 CCCCCTTCCCTCCACTCCTTCTT 0: 1
1: 3
2: 49
3: 910
4: 6957
Right 951546373 3:23830005-23830027 GCTAGCTACACCTGGAATTTTGG 0: 1
1: 0
2: 0
3: 1
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951546363 Original CRISPR AAGAAGGAGTGGAGGGAAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr