ID: 951548899

View in Genome Browser
Species Human (GRCh38)
Location 3:23857147-23857169
Sequence TAGGAGAAGCATCAGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951548899 Original CRISPR TAGGAGAAGCATCAGGAAAT TGG Intronic
900787608 1:4658515-4658537 TAGTAGCAGCAGCTGGAAATCGG - Intronic
900935616 1:5764663-5764685 CAGCAAAGGCATCAGGAAATGGG - Intergenic
902025843 1:13382861-13382883 GAGGAGCAGCATCAGGCAGTTGG - Intergenic
902995660 1:20222882-20222904 TATGAAAAGCATCATGAAAAAGG + Intergenic
903348700 1:22704579-22704601 TAGGAGAACCATCAGGGAGGTGG - Intergenic
903451710 1:23458019-23458041 TAGGAAAAGCACCTGGAACTTGG - Intronic
904225634 1:29015976-29015998 TATCATAAGTATCAGGAAATTGG + Intronic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904716865 1:32474943-32474965 CACAAGAAGTATCAGGAAATAGG + Intronic
906206058 1:43987018-43987040 TGGGAGAAGCATGAGGCACTGGG + Intronic
908680822 1:66659213-66659235 TAGGAGATGAAGCTGGAAATAGG + Intronic
911167079 1:94733872-94733894 TGGGAGAAGCATCAGTGCATGGG - Intergenic
912582070 1:110729832-110729854 GAGGAGAAGCATCTGGATGTTGG + Intergenic
913432675 1:118812507-118812529 TAGGAGAAGCACAAAGAAAGAGG + Intergenic
915278457 1:154806092-154806114 CATGAGAAACAACAGGAAATGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917853640 1:179084993-179085015 TGGGAGCAGCCTCAGGACATGGG + Intronic
918841212 1:189542084-189542106 TAGGAAAAGAAACAGGATATAGG - Intergenic
919515970 1:198523632-198523654 TAGGACAATCATCAGTAAACAGG - Intronic
920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG + Intergenic
920903521 1:210136484-210136506 TAGGAAAAGCATCACACAATGGG - Intronic
921979092 1:221235707-221235729 TAGGAGAAGAATGAAGAACTGGG - Intergenic
922033223 1:221824588-221824610 TTCAAGAAGAATCAGGAAATGGG - Intergenic
922981053 1:229827249-229827271 CAGGGGAAGCATTAGAAAATAGG - Intergenic
923397778 1:233584050-233584072 GAGGAGAAGCAGCTGGACATTGG + Intergenic
924256157 1:242184964-242184986 GAGGAGAAACAGCAGGAATTGGG - Intronic
924664748 1:246059673-246059695 TTTGAGAAGCTTCAGGAAAAAGG + Intronic
1062927785 10:1329841-1329863 CATGAGGAGCATCAGCAAATCGG - Intronic
1062944965 10:1453347-1453369 TAGGGGAAGCGTCATGACATTGG - Intronic
1063073472 10:2690638-2690660 TAGGAGGAACATACGGAAATGGG - Intergenic
1063430826 10:5986561-5986583 TGGGTGAATCATCAAGAAATAGG - Intergenic
1063972261 10:11389329-11389351 TAAGAGAAGGTTCAGGAAAAGGG + Intergenic
1064540481 10:16399932-16399954 GAGGAGAAAAATCAGTAAATAGG + Intergenic
1065816785 10:29489918-29489940 TAAGAAAAACATTAGGAAATAGG + Intronic
1068941788 10:62687946-62687968 CAGGAGAAGCAACAAGAAATTGG + Intergenic
1069616287 10:69808368-69808390 TAGGAAGAGCAACAGGAAGTTGG - Intronic
1069766850 10:70868512-70868534 GAAGAGAAGCAGCAGGAAAATGG - Intronic
1069908992 10:71748569-71748591 TAGGAGATCAATCAGGAATTAGG - Exonic
1070458706 10:76643548-76643570 GAGGGGAAGCATCAGGATAAAGG + Intergenic
1070802539 10:79251976-79251998 CAGGAGCAGCATCAGGACAGGGG + Intronic
1071284470 10:84131776-84131798 TAGGAGAAGGATCACCAAACAGG - Intergenic
1072109387 10:92303986-92304008 TAGGAGTAACATCAGCAAGTAGG + Intronic
1072197273 10:93127000-93127022 TAGGAAAGGCTTCAGGAAATGGG + Intergenic
1072441833 10:95463864-95463886 TGAGAGAACCATCAGGAAATGGG + Intronic
1075014834 10:118903236-118903258 GAGCAGAAGCAGCAGGAAATTGG + Intergenic
1075778517 10:125002871-125002893 TTGGAGAAGCAGCTGGAACTGGG - Intronic
1075814588 10:125255090-125255112 TAAGAGAAGCATCAGAAATGAGG - Intergenic
1075985186 10:126779119-126779141 AAGGGGAAGCACCAGGAAAGGGG - Intergenic
1076224853 10:128765779-128765801 CAGGAGAACCCTCAGGAAATGGG + Intergenic
1076830100 10:132989841-132989863 TTGGAGAAGCAACGGGAAGTGGG + Intergenic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1077931558 11:6738276-6738298 TAGTAGAAGTACCAGGAGATGGG - Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078705959 11:13744641-13744663 TATGAGAAGGAGCAGGAAAACGG - Intergenic
1079608434 11:22399658-22399680 TAGGAGAAGACTCAGCAAAAAGG + Intergenic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1081323614 11:41719382-41719404 TAGGGGAAGCATCAGGCTGTTGG + Intergenic
1082180072 11:49106470-49106492 TAGGAGAAGCCCCAGGCAATGGG - Intergenic
1084723148 11:70922177-70922199 TAGGAGATGGATAAGGAAATTGG + Intronic
1085553256 11:77395089-77395111 TAGTTGAAGCATAGGGAAATTGG - Intronic
1085704676 11:78776013-78776035 TAAGAGAAACATAAAGAAATGGG - Intronic
1086685421 11:89728457-89728479 TAGAAGAAGCCCCAGGCAATGGG + Intergenic
1086853193 11:91835870-91835892 TAGGAGTAGTTCCAGGAAATAGG + Intergenic
1087115486 11:94520310-94520332 TAGGAGCAAAACCAGGAAATTGG - Intergenic
1087655235 11:100914723-100914745 TAGCAGAAGGATCAGGAGAGAGG - Intronic
1088072315 11:105803984-105804006 GAGGAGAAGAATGAGGAATTTGG + Intronic
1088433659 11:109786265-109786287 TGGTACAAGCATAAGGAAATAGG - Intergenic
1088872752 11:113905728-113905750 TAGGAGAAACCTCAAGAAAGTGG - Intronic
1089383907 11:118055770-118055792 TAGGCCAGGCATCTGGAAATGGG + Intergenic
1090829956 11:130414473-130414495 AAGGAGAAACAAAAGGAAATGGG - Intronic
1091003645 11:131932390-131932412 AAGAAGAAACATCAGGAAAAAGG + Intronic
1092355282 12:7789486-7789508 AAGGAAAAGTATCAAGAAATTGG - Exonic
1093566456 12:20610889-20610911 CAGGGGAAGGGTCAGGAAATGGG + Intronic
1093574170 12:20707284-20707306 AAGGAGAAGAATGAGAAAATGGG + Intronic
1095229403 12:39720235-39720257 TAAGAAGAGCATCAGGTAATAGG - Intronic
1097292792 12:57933174-57933196 TAAGAGAAACATCAGGAGAGTGG - Intergenic
1098157143 12:67611063-67611085 TAGCAGAAGCCTCAGTAAAACGG + Intergenic
1100109999 12:91229292-91229314 AAGAAGAAGCATCAGGACAGAGG + Intergenic
1100729624 12:97449974-97449996 TAGAAGAAACATCAGGATAGGGG - Intergenic
1102268884 12:111513223-111513245 TAGTAGAATCACCAGGAATTGGG - Intronic
1102621782 12:114201901-114201923 TAGGAGCAGGATCAGGAGTTAGG + Intergenic
1102909039 12:116698542-116698564 AAGTAGAAGCAACAGGAATTTGG - Intergenic
1103049784 12:117769004-117769026 TAGGAAATGCAGAAGGAAATTGG + Intronic
1103151892 12:118648094-118648116 TGGGAGAAGTATCAGGATGTGGG + Intergenic
1104053812 12:125214408-125214430 TGTGAGAACCATCAGGAAAGAGG - Intronic
1104106511 12:125665006-125665028 TTGGAGAAGGCACAGGAAATAGG + Intergenic
1104554889 12:129790551-129790573 GAGGAGAAGCAGCTGGACATCGG - Intronic
1104572957 12:129941556-129941578 TAGGAAAAGAAGCAGGTAATTGG + Intergenic
1105687618 13:22801136-22801158 TAGGAAAAGCATGAGAACATTGG - Intergenic
1106066842 13:26361045-26361067 TAGGAAAAGGGTCAGCAAATAGG - Intronic
1106109393 13:26763128-26763150 AAGGAGAAGCTACAGGAAACAGG + Intergenic
1106373656 13:29162417-29162439 TAGACAAAGCATCAGGAACTTGG - Intronic
1107202582 13:37739261-37739283 TAGAAGAAGCATAAGGGAAAAGG + Intronic
1108271875 13:48769736-48769758 GAGGAGAAACATCAGGAAAAGGG - Intergenic
1108561200 13:51646019-51646041 AAGTAGAAGCATCAGGACTTGGG - Intronic
1108604155 13:52020523-52020545 TAGGAAAAGCATCACGGAGTTGG - Intronic
1108782157 13:53849320-53849342 TATGAGACACATAAGGAAATAGG - Intergenic
1109355151 13:61225117-61225139 TAGGAGAAACATCACAAAACGGG + Intergenic
1110315514 13:74101781-74101803 TATGAAAAACATCAGTAAATGGG + Intronic
1110849195 13:80224638-80224660 TAGGAGGAGGATGAGGAAGTTGG + Intergenic
1112090402 13:96077349-96077371 TAAGAGAAAGATCAGGAATTTGG + Intergenic
1112293866 13:98169178-98169200 AAGGTGAAGCACCAGGAAAAAGG - Intronic
1112391825 13:98992181-98992203 CAGGATAAGCTTCAGGAGATGGG + Intronic
1112779768 13:102886732-102886754 CAGGAGAAGCATCATAAAAGAGG - Intergenic
1112971043 13:105263109-105263131 TAGGAGATACATATGGAAATTGG - Intergenic
1113531504 13:111030724-111030746 TAGGAGCAGCATGTGGAAAACGG - Intergenic
1114503573 14:23190660-23190682 TAGGAGAAACATGTGGAAATTGG - Intronic
1114568398 14:23648764-23648786 TAGGAGATGCAGCAGGCAATGGG + Intergenic
1114621504 14:24098999-24099021 TGGCAGCAGCATCAGGAACTGGG - Intronic
1114769896 14:25417145-25417167 AAGGTGGAGCATCAGGACATTGG - Intergenic
1115202425 14:30869061-30869083 TAGGTGAAAAATAAGGAAATCGG + Intergenic
1115245182 14:31287395-31287417 GAGGAGAAGCAGCTGGACATAGG - Intergenic
1115886569 14:37978302-37978324 TAGGAAAAGAATAAGGAAAAGGG + Intronic
1116425608 14:44786659-44786681 TTGGAGAAGCTTCAGAAAAAGGG + Intergenic
1119230607 14:72976482-72976504 GAGGAGAAAAATAAGGAAATCGG + Intronic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1119539649 14:75429419-75429441 TTGGAGGAGCATCAGGAATTGGG + Intronic
1119710357 14:76817752-76817774 TAGGAACATCATCAGGAAAAGGG - Intronic
1120426179 14:84351056-84351078 AAGGAGAAGGAAGAGGAAATGGG + Intergenic
1121224728 14:92312897-92312919 TTGGAGAAGCAACAAGAAATTGG + Intergenic
1122641673 14:103163646-103163668 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1124637328 15:31373555-31373577 AAGGAGAAGCAGGAGGAAAAGGG - Exonic
1125032332 15:35085217-35085239 AAGGAAAAGTATCAAGAAATTGG + Intergenic
1126390419 15:48143736-48143758 TCAGAGAAGCTTCAGGAAAGAGG + Intronic
1126450783 15:48806340-48806362 CAGAAGCAGCAGCAGGAAATGGG + Intronic
1126552310 15:49946502-49946524 TAAAGGAAGCAACAGGAAATTGG - Intronic
1126865255 15:52929728-52929750 CAGGAAAAGCTTCATGAAATTGG - Intergenic
1129078814 15:73021575-73021597 TAGCAGAAGCAGACGGAAATAGG - Intergenic
1129553505 15:76479560-76479582 TAGGAAAAGCATCATAAAATTGG + Intronic
1129567815 15:76642650-76642672 AAGGAATAACATCAGGAAATGGG - Intronic
1130758120 15:86788056-86788078 AAGTAGAAGGATGAGGAAATGGG + Intronic
1131171476 15:90181903-90181925 GAGGAGAAGGAGCAGGAAAAGGG + Intronic
1131210217 15:90488641-90488663 TAAGAGAAGTTTCAGGAAAGAGG + Intronic
1133058673 16:3160260-3160282 CAGGACAAGCATCGGGAAAGGGG + Intergenic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133587227 16:7207769-7207791 TAGGAGAAGCTACATGAACTGGG - Intronic
1133759034 16:8783375-8783397 GAATAAAAGCATCAGGAAATCGG + Exonic
1134320244 16:13156157-13156179 TAGGTTAAGCAGCAGAAAATTGG + Intronic
1138893626 16:61175942-61175964 TAGGAAAAGAATCTGGAAAAAGG - Intergenic
1140564588 16:76026908-76026930 GAGGAGAAGCAACTGGACATTGG + Intergenic
1141137597 16:81476812-81476834 AGGGAGAAGAAACAGGAAATGGG - Intronic
1142611770 17:1112370-1112392 TCTGAGTAGCATCTGGAAATAGG + Intronic
1142650557 17:1348539-1348561 TAGGAGAATCGTCATGAAAGTGG - Intronic
1146174011 17:30653363-30653385 GAGGAGAGGCAGAAGGAAATAGG - Intergenic
1146347466 17:32069390-32069412 GAGGAGAGGCAGAAGGAAATAGG - Intergenic
1147936678 17:44015323-44015345 TATGAGACTCATCATGAAATGGG + Intronic
1152004317 17:77669270-77669292 CAGGAGAAAAATCAAGAAATGGG - Intergenic
1153713508 18:7823080-7823102 TAGGAGAAACATTAGGACAGTGG - Intronic
1155807094 18:30185004-30185026 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1156300672 18:35833463-35833485 TAGGAGAAGGATCTGGGACTGGG - Intergenic
1158068423 18:53441235-53441257 TCAGATAAGCATCAGGAAAGTGG + Intronic
1159228151 18:65567888-65567910 AAGGAGAAGAATTAGGAAAGAGG + Intergenic
1159377845 18:67616757-67616779 TATGAGAAGTGTCAGGCAATGGG - Intergenic
1159582181 18:70245710-70245732 GAGGAGAAGCAGCTGGACATCGG + Intergenic
1160969445 19:1760941-1760963 TTGGAGAAGCAGCACGGAATGGG - Intronic
1162637083 19:11977417-11977439 CAGGAGAAACTTCAGGTAATTGG + Exonic
1163126092 19:15244953-15244975 TAGGAAAAGCAGCAGGCAAGTGG - Intronic
1163791193 19:19306950-19306972 GGGGAGCAGCATCATGAAATTGG + Intronic
1167178840 19:47885722-47885744 TAGGAGAATCATCAGGGCAATGG - Intronic
1167423836 19:49419291-49419313 AAGGAGAAGGATCACGAGATTGG + Intergenic
925273635 2:2633472-2633494 GAGGAGAAGGAACAGGAAACGGG - Intergenic
925748690 2:7067749-7067771 TAGGAGAAGCTTCAGGTGACTGG - Intronic
926542994 2:14204447-14204469 GAGGAGAAGCAGCTGGACATCGG + Intergenic
927093843 2:19732765-19732787 GAGGAGAAGTGCCAGGAAATGGG + Intergenic
928301544 2:30129754-30129776 TAGGAGAAGCTTCAGACAATGGG - Intergenic
928860062 2:35846569-35846591 GAGGAGAAGCAGCTGGACATCGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932333271 2:70912995-70913017 TGGGAGGAGCATCTGGAAAGAGG - Intronic
932693834 2:73936980-73937002 GAGGAGGCGCTTCAGGAAATGGG + Intronic
933375962 2:81480248-81480270 TAGAAGAAGCCCCAGGACATTGG - Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
936588680 2:113782109-113782131 TAGGAGACACATCAGGAAAGGGG + Intergenic
937073967 2:119087601-119087623 CTGTAGAAGCATCTGGAAATGGG - Intergenic
937694665 2:124795320-124795342 TAGGAGAAGGAGCTGGAAATGGG - Intronic
937891213 2:126940427-126940449 GAGGAGAAGCAGCTGGACATAGG - Intergenic
940425805 2:153530949-153530971 TTGGAGAAACTTCAGGACATTGG + Intergenic
940687550 2:156872719-156872741 TAGGAAAAGCATAAGGGAAATGG + Intergenic
940862767 2:158787555-158787577 GAGGAGAAGCAGCTGGACATTGG - Intergenic
941204681 2:162557305-162557327 TAGAAGAAGCATCCAAAAATGGG + Intronic
942744846 2:179220378-179220400 TAGGAGCAGCAAAAGGAAAAAGG + Intronic
942979338 2:182060731-182060753 TAGCATAAGGATCAGGAAAGAGG + Intronic
943286255 2:186004962-186004984 GAGGAGCAGCATCAGGTAGTTGG - Intergenic
943789430 2:191915738-191915760 GAGGAGAAGGATCAGGAAAGAGG + Intergenic
944355145 2:198778728-198778750 TAGGAAAAGCATCAAGAGTTAGG - Intergenic
944748390 2:202681972-202681994 GAGGAGAAGCAGCTGGACATTGG + Intronic
944834871 2:203569488-203569510 TTGGAGGAGCAAGAGGAAATAGG + Intergenic
945235846 2:207630657-207630679 CAAGAGAGGCATCAGGAAAACGG - Intergenic
945653627 2:212596170-212596192 TGGGAGAAGCATAAAGGAATAGG + Intergenic
946049753 2:216852633-216852655 TAGGAGAGGTAACAGAAAATGGG - Intergenic
946563628 2:220940225-220940247 GAGGAGAAGCATCTGGATGTTGG + Intergenic
947479507 2:230485566-230485588 TAGGAGATGCAATAAGAAATGGG - Intronic
948325399 2:237115700-237115722 AAGGAGAAAGATCAGGAAATTGG + Intergenic
1169410387 20:5364319-5364341 GAGGGGAAGCATCAGGTAGTTGG + Intergenic
1170427697 20:16251747-16251769 TAGGATAACAAACAGGAAATTGG - Intergenic
1170758067 20:19222572-19222594 TAGGAGAGGAATCTGGGAATGGG + Intronic
1172421735 20:34824724-34824746 TGGGGGAAGCAACAGGAAAAAGG - Intronic
1173444773 20:43107709-43107731 GAGGAAAATCATCAGGAACTCGG + Intronic
1176717399 21:10364660-10364682 AAGGAGAAGCAGGAGGCAATGGG - Intergenic
1177711294 21:24778405-24778427 TCTGAGAAGCAGCAAGAAATTGG - Intergenic
1179359473 21:40692344-40692366 TAGTAGAATCTTCAAGAAATAGG + Intronic
1179482483 21:41687072-41687094 TAAGAGAAGCTTGAGGACATTGG - Intergenic
1180298625 22:11017580-11017602 AAGGAGAAGCAGGAGGCAATGGG - Intergenic
1180600944 22:17015333-17015355 AAGGAGAAGCAGGAGGCAATGGG + Intergenic
1182799544 22:33020381-33020403 TCAGAGAAGCCTCAGGACATAGG + Intronic
949351414 3:3127581-3127603 CAGGAAAAGAATCAGGAAAATGG + Intronic
951548899 3:23857147-23857169 TAGGAGAAGCATCAGGAAATTGG + Intronic
952981745 3:38741740-38741762 TAACAAAAGCATCAGGAAGTCGG - Intronic
953570422 3:44067207-44067229 TCAGAGAAGGATCATGAAATTGG + Intergenic
953645247 3:44747514-44747536 TAGAAGCAGCATGAGGAAACAGG + Intronic
954554758 3:51509080-51509102 TATGAGAAGCATCAGGGCCTTGG + Intergenic
956616919 3:71181611-71181633 TAGCAGAAACAACATGAAATGGG + Intronic
956699770 3:71948607-71948629 TAGGAGAGACCTCTGGAAATAGG - Intergenic
957631359 3:82720055-82720077 TAGGATAATAATCAGGAGATAGG + Intergenic
959550314 3:107648497-107648519 TAGGATGAGAATGAGGAAATGGG + Intronic
959769443 3:110074849-110074871 TTGAAGAAGGATAAGGAAATGGG - Intergenic
960825064 3:121773817-121773839 CAGGAAAAGCATCATGACATTGG + Intronic
960996899 3:123346185-123346207 TGGGAGAAGCAGCAGGGAAATGG + Intronic
961003058 3:123386794-123386816 TAGGAGAAGTTACAGGAAACGGG - Intronic
961579074 3:127863270-127863292 TAGGTGAAGTTTCAGGCAATGGG - Intergenic
962092915 3:132263806-132263828 TAGGAGAAGCTGTGGGAAATTGG - Intronic
962331720 3:134484692-134484714 AAGGAGTAGCAGCAGGAAAGTGG - Intronic
962802812 3:138904817-138904839 TAGGTGAAGATTAAGGAAATCGG - Intergenic
964177447 3:153841229-153841251 TAGGAGAAGCAATAAGAATTGGG + Intergenic
964719074 3:159753918-159753940 TGGGGGAGGTATCAGGAAATGGG - Intronic
964877952 3:161390711-161390733 TAGGAGAACCAAAAGGAAAAAGG + Intergenic
965300840 3:167002642-167002664 GAGGAGAAGCAGCTGGACATGGG - Intergenic
965476549 3:169162487-169162509 TAGGGGAAGCTTCATGAAAGAGG + Intronic
966099036 3:176243432-176243454 GAGGAGCAGCATCAGGCAGTTGG - Intergenic
968309860 3:197674506-197674528 GAGGAGAAGCAGCAGAGAATAGG - Intronic
970566844 4:17339982-17340004 TAGGAGAAACCCCATGAAATAGG + Intergenic
970713166 4:18888028-18888050 TAGGAGAAACATCAGGAGAGTGG + Intergenic
971619442 4:28836344-28836366 TAGGAGTAGCATCTGGCAATAGG + Intergenic
971937524 4:33171474-33171496 GAGGAGTAGAATCTGGAAATAGG + Intergenic
971975741 4:33684045-33684067 TAGGTGAAAAATCAAGAAATAGG + Intergenic
974322780 4:60373391-60373413 TGGAAGAAGCTTCATGAAATTGG - Intergenic
975091010 4:70404265-70404287 TAGGAGAAAAATCAGGAGAGTGG - Intronic
977137990 4:93330312-93330334 TAAGAGAAGAATCAGGAGTTAGG + Intronic
977342724 4:95779735-95779757 TAGGAAAAAGATCAGGAAATTGG - Intergenic
977434122 4:96971491-96971513 TAAGAGAAGCAGAAGGAATTAGG - Intergenic
977490000 4:97699480-97699502 TGGAAGAAGCATAAGAAAATTGG - Intronic
977781483 4:100986200-100986222 AAGGAGAAGCAGCTGGACATTGG + Intergenic
977787350 4:101052914-101052936 TAGGGGAGGCAGCAGGAATTGGG - Intronic
980451016 4:132971856-132971878 TAGATGCAACATCAGGAAATAGG + Intergenic
980456056 4:133045185-133045207 TTGGGGGAGCATCATGAAATAGG + Intergenic
980594681 4:134938157-134938179 GAGGAAAAGCTTCATGAAATTGG + Intergenic
981153064 4:141401362-141401384 TGGGAGCAGCCTCAGGAAAGTGG - Intergenic
981700823 4:147605531-147605553 TAATGGAAGCATCAGGGAATTGG + Intergenic
982807779 4:159788141-159788163 TAGGAGAAACCACAAGAAATTGG - Intergenic
983018088 4:162639926-162639948 GAGGAGAAGCAGCTGGACATCGG + Intergenic
983463937 4:168062798-168062820 CGGGAGATGCATCAGGATATTGG + Intergenic
983497865 4:168463805-168463827 TAGGAGTAGGATGAGGGAATGGG + Intronic
983513493 4:168633031-168633053 TAAGAAAATCATCAGGATATTGG + Intronic
984713638 4:182905975-182905997 TAGGGGCAGCATCAGGAAGATGG - Intronic
986009517 5:3699757-3699779 GAGGGGATGCAGCAGGAAATGGG - Intergenic
986230639 5:5861876-5861898 AAACAGAAGCATCAGGAAAGTGG - Intergenic
986595982 5:9422417-9422439 GAGAAGAAGCATCATGAAAGGGG + Intronic
988051767 5:26040937-26040959 TGGGAGAAGCTTCTGGACATGGG + Intergenic
989010623 5:36868126-36868148 TAGGAAAAGCATCAAAAAAGTGG - Intergenic
989529943 5:42496350-42496372 TAGGAGAAGGTTTAGCAAATTGG + Intronic
990129290 5:52559933-52559955 TAAAAGAAGCATCAGAAGATTGG - Intergenic
991215588 5:64154922-64154944 TAGGAGAAGGATCTGGGACTGGG - Intergenic
994039159 5:95238057-95238079 TAGCAGAAGCAGCATGAAATCGG + Intronic
994111088 5:96005233-96005255 TAGGGGATGAAACAGGAAATTGG + Intergenic
995654732 5:114412740-114412762 TAAGTAAATCATCAGGAAATAGG - Intronic
996448543 5:123588439-123588461 AAGGAGAGGTATCAGAAAATTGG + Exonic
996648612 5:125846012-125846034 TAGGACAAGGATGAGGGAATTGG - Intergenic
996767475 5:127048914-127048936 TAGGAGAAGAATCAGCAACCTGG + Intronic
998787273 5:145726605-145726627 TAGGACCAGGATCAGGAAGTTGG + Intronic
999064987 5:148676006-148676028 TGTGAGAAGCAGAAGGAAATCGG - Intronic
999384460 5:151144586-151144608 GAGGAGCAGCAATAGGAAATTGG - Intronic
1000585493 5:163092607-163092629 TAGGAGGAGCCTAAGGAAACAGG + Intergenic
1001108954 5:168879500-168879522 GAGGAGAAGCATCTGGACAGAGG - Intronic
1001145988 5:169185251-169185273 AAGGAGAAAAATCAGGAAATCGG + Intronic
1001877383 5:175213313-175213335 TAGGACAAGCCCCAGGAAAGTGG - Intergenic
1005141471 6:22636725-22636747 TAAGAGAAGCAACAGGATCTTGG - Intergenic
1005258151 6:24026942-24026964 AAGGGGAAGGAGCAGGAAATAGG - Intergenic
1005705902 6:28452557-28452579 TAGGAGAATGATGAGTAAATTGG - Intergenic
1005746768 6:28845543-28845565 GAGGAAAAGCTTCAGGACATTGG + Intergenic
1006662640 6:35660999-35661021 TAGGGGAAACAGGAGGAAATGGG + Intronic
1007083360 6:39124873-39124895 ATGGAGAAGCTTCAGGTAATAGG - Intergenic
1007686470 6:43670035-43670057 CAGGAGAGGCTTCAGGAAATGGG + Intronic
1007771087 6:44192822-44192844 TAGGAGAGGCAGGAGGAAACAGG - Intergenic
1007794566 6:44337348-44337370 TAGGAAAAGCAGCAGGGAATGGG + Intronic
1007848824 6:44783664-44783686 TAGTAGAAGCATCATGAATCAGG - Intergenic
1009216807 6:60930994-60931016 TAGGAGAAGCATCTGTTAGTTGG - Intergenic
1009658527 6:66578224-66578246 TCAGAAAAGCAACAGGAAATAGG - Intergenic
1009895352 6:69742819-69742841 TATCAGTAGCAACAGGAAATAGG - Intronic
1010156735 6:72802945-72802967 TGGAAGAATCATAAGGAAATAGG - Intronic
1010304043 6:74296438-74296460 TGGGAGAAGAATCAGGCAATGGG - Intergenic
1010930745 6:81799987-81800009 GAGAAGCAGCATCAGGAGATTGG + Intergenic
1011294468 6:85811189-85811211 TAGGAGAAGCAGCTGGACATTGG - Intergenic
1011742008 6:90371379-90371401 GAGAAAAAGGATCAGGAAATGGG - Intergenic
1011899547 6:92275234-92275256 GAGGAGAAGCAGCTGGATATTGG - Intergenic
1012035586 6:94134343-94134365 TCTGAGCAGCATCAAGAAATAGG - Intergenic
1012850522 6:104441292-104441314 TAGGAGAATCTTCATGAAATAGG - Intergenic
1014895724 6:126897146-126897168 TAGTAGGAGCATCAGGGACTTGG + Intergenic
1016562790 6:145415864-145415886 TCAGAGAAGCATAAGCAAATGGG - Intergenic
1016924172 6:149325620-149325642 TAGGAAAAGCATTAGAAAATTGG + Intronic
1017003147 6:150009870-150009892 TAGGAAAATTATCAGGAAAATGG - Intergenic
1017582436 6:155881106-155881128 TATGAGAAGAAACAGGACATAGG + Intergenic
1018445593 6:163855330-163855352 CAAGAGAAGCATAAGGAAAGAGG - Intergenic
1019297165 7:283893-283915 TAGGACAACCATTAGGAAAAGGG + Intergenic
1020254854 7:6497404-6497426 TAGGAGCAGGATCAGAAAAAAGG + Intergenic
1020383341 7:7569480-7569502 AAGTGGAAGCATGAGGAAATAGG + Intronic
1020652797 7:10895307-10895329 TGGTAGGAGAATCAGGAAATTGG + Intergenic
1021145655 7:17085473-17085495 TAGGAAAAGGACCAGGAAAGAGG - Intergenic
1021802360 7:24319755-24319777 AAGGAGGAGCATCAGAGAATTGG + Intergenic
1023339345 7:39203296-39203318 TAGGACAAACATCAGGAAAAAGG + Intronic
1023440457 7:40179994-40180016 TAGGCAAAGCATCAGAAAAAGGG - Intronic
1024172858 7:46808521-46808543 TAGGGGAAGCATCAGGAGACTGG - Intergenic
1024533096 7:50409344-50409366 GAGGAGAAGCAGGAGGAATTAGG + Intergenic
1024605356 7:51018438-51018460 ATGGAGGAGCATCAGGAAAAGGG - Intronic
1025307401 7:57874619-57874641 AAAGAGGAGCATCAGGAAAATGG - Intergenic
1025849330 7:65233090-65233112 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1027893529 7:84009743-84009765 AAGGAGAAGGATGAGGAAAGAGG + Intronic
1028642771 7:93061928-93061950 TAGGAGAATCATCATGAATCTGG - Intergenic
1029358129 7:100068063-100068085 TGGGAGAGCCATCAGGACATGGG + Intronic
1031185829 7:118478767-118478789 TTAGAGAAGCATCAGAAATTAGG - Intergenic
1031207727 7:118782202-118782224 TGGGAGGAAAATCAGGAAATTGG - Intergenic
1031469465 7:122151724-122151746 TAGGAGAAAGATCAGGAGTTTGG + Intergenic
1031945194 7:127832390-127832412 TTAGAGAAGCATGTGGAAATTGG + Intronic
1035790279 8:2297885-2297907 GAGGAGAAGGATCAGGATAATGG - Intergenic
1035802526 8:2423820-2423842 GAGGAGAAGGATCAGGATAATGG + Intergenic
1036483890 8:9162513-9162535 AAGGAGAATGAGCAGGAAATGGG + Intronic
1036764980 8:11543730-11543752 TGGGATAAGCATCATGAAACAGG + Intronic
1037427409 8:18771100-18771122 GAGGAGAAGCAGCTGGACATTGG - Intronic
1041930067 8:63276887-63276909 TATGAGAAGCATCAGTAATCAGG - Intergenic
1042205828 8:66328844-66328866 AAGGGGCAGCATCAGGAAGTTGG - Intergenic
1042670320 8:71255644-71255666 TAGGAAAAGCTTCATGACATTGG + Intronic
1042819735 8:72916883-72916905 GAGGAGAAGCAGCTGGACATTGG - Intronic
1043950090 8:86299072-86299094 TAGCAAAAGGATCAGGAAAGGGG - Intronic
1044286839 8:90419911-90419933 GAGGAGAAGCAGCTGGACATTGG - Intergenic
1044371354 8:91415175-91415197 TAGGGGAAGCAGCTGGACATGGG + Intergenic
1046673583 8:117084212-117084234 GAGGAGAAGAATAAAGAAATTGG + Intronic
1047567317 8:126059813-126059835 TTGGAGATGCAGCAGGACATGGG + Intergenic
1048543158 8:135361466-135361488 CAGGAAAAGCACCAGGGAATTGG + Intergenic
1048822749 8:138394883-138394905 AAGCAGCAGCTTCAGGAAATAGG + Intronic
1051209473 9:14726516-14726538 AAGGAGCAGCTTCAGGGAATGGG - Intergenic
1051402332 9:16696447-16696469 AAGAAGTGGCATCAGGAAATAGG - Intronic
1052781656 9:32787294-32787316 TGGGAGAAGAAACATGAAATAGG - Exonic
1052796152 9:32925263-32925285 GAGGAGAGGTATCAGGAATTAGG - Intergenic
1054871848 9:70054371-70054393 TATGAGAAGAATTAGGAAAGTGG + Intronic
1055551853 9:77438888-77438910 AATGATCAGCATCAGGAAATAGG + Intronic
1055588290 9:77781179-77781201 TAGGGGAAACATCAGGACATAGG - Intronic
1056427107 9:86488402-86488424 GAGGAGAAGCAGCTGGACATCGG + Intergenic
1057404389 9:94755746-94755768 AAGGAAAAGCATCAGCAAGTGGG + Intronic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058444046 9:105038416-105038438 TAGGAAAAGAACCAGAAAATTGG - Intergenic
1060309055 9:122442963-122442985 TAGGAGAAGCATCCTGGAAGAGG - Intergenic
1060990023 9:127843249-127843271 TTGGAGAAACATCCGGAAAGAGG + Intronic
1186594002 X:10960963-10960985 AAGGAGATGCAGCAGGAATTAGG - Intergenic
1187128050 X:16472504-16472526 AAGGAGAAGGATGAGTAAATAGG - Intergenic
1188779603 X:34265011-34265033 CAGGAGAAGGATGAGGAAAGGGG + Intergenic
1189115552 X:38338760-38338782 GAAGAGAGGCAGCAGGAAATTGG + Intronic
1189785484 X:44555463-44555485 GAGGAGAAGCAGCAGGCGATTGG - Intergenic
1190259686 X:48790085-48790107 GAGGAGAAGGATGAAGAAATTGG + Intronic
1191940423 X:66474396-66474418 TGTGAGAAGCATGGGGAAATGGG - Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1193339879 X:80335349-80335371 CAGGAGCAGAAACAGGAAATGGG - Intergenic
1193818885 X:86137827-86137849 TAGGACAATTAACAGGAAATAGG - Intergenic
1193825514 X:86221138-86221160 AAGGAAAAGCATCATGGAATTGG - Intronic
1195721309 X:107871808-107871830 GAGGAGAAGCAGCTGGACATTGG - Intronic
1197456650 X:126684340-126684362 CAGTAGAAGCATAAGGAAAGGGG + Intergenic
1197854460 X:130900497-130900519 TAGGAGAAGAGTCTGGAAAGAGG - Intronic
1198017767 X:132629296-132629318 TAGCTGAAGTATCAGCAAATTGG - Intronic
1198427614 X:136535703-136535725 TAGAGAGAGCATCAGGAAATGGG - Intronic
1199552287 X:149073485-149073507 TAGGAGAAGAAACAGATAATAGG - Intergenic