ID: 951549409

View in Genome Browser
Species Human (GRCh38)
Location 3:23861922-23861944
Sequence CTCTGTCCTTGCCATAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 8, 1: 40, 2: 87, 3: 103, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951549405_951549409 -6 Left 951549405 3:23861905-23861927 CCAGGATACAGAAAGCCCTCTGT 0: 158
1: 206
2: 114
3: 62
4: 202
Right 951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG 0: 8
1: 40
2: 87
3: 103
4: 210
951549400_951549409 28 Left 951549400 3:23861871-23861893 CCACATGTGATCCTATTCTTCTG 0: 1
1: 9
2: 78
3: 159
4: 438
Right 951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG 0: 8
1: 40
2: 87
3: 103
4: 210
951549399_951549409 29 Left 951549399 3:23861870-23861892 CCCACATGTGATCCTATTCTTCT 0: 1
1: 8
2: 84
3: 217
4: 479
Right 951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG 0: 8
1: 40
2: 87
3: 103
4: 210
951549404_951549409 0 Left 951549404 3:23861899-23861921 CCAAAGCCAGGATACAGAAAGCC 0: 1
1: 0
2: 1
3: 13
4: 217
Right 951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG 0: 8
1: 40
2: 87
3: 103
4: 210
951549402_951549409 17 Left 951549402 3:23861882-23861904 CCTATTCTTCTGGTATGCCAAAG 0: 1
1: 0
2: 7
3: 71
4: 241
Right 951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG 0: 8
1: 40
2: 87
3: 103
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951549409 Original CRISPR CTCTGTCCTTGCCATAAGGC AGG Intronic
901537661 1:9893060-9893082 CACTGTCCTTGCCTTCAGACTGG - Intronic
903242157 1:21990283-21990305 CCCTGAACTTGCCACAAGGCAGG - Intronic
903245667 1:22013470-22013492 CCCTGAACTTGCCACAAGGCAGG - Intergenic
903332629 1:22603787-22603809 GTCTGTCCTTGGCTTTAGGCAGG - Intergenic
904362245 1:29983794-29983816 AGCAGGCCTTGCCATAAGGCAGG - Intergenic
906203205 1:43972861-43972883 GTCTGTCCTTGTCAAAAGGCAGG + Exonic
906792431 1:48670620-48670642 CCCCTTCCTTGCCATAGGGCTGG + Intronic
907044191 1:51289706-51289728 CTCTATCCTTGCCCTCAGGGAGG - Intronic
907962210 1:59294313-59294335 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
909013903 1:70363264-70363286 CTCCTCCCTTGCCATGAGGCAGG + Intronic
909818515 1:80027795-80027817 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
909863016 1:80632778-80632800 CTCTGTCCTTGCTATAAGGCAGG + Intergenic
909920925 1:81379413-81379435 CTCTCTCCTTGTGATAAGGAAGG - Intronic
910157750 1:84239506-84239528 CTCTGTCCTTGCCCTATAGATGG - Intergenic
911587243 1:99705011-99705033 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
913043355 1:115051940-115051962 CTTTATCATTGCCATAAGGTTGG + Intronic
914885621 1:151582018-151582040 CTCTGGCTGTGCCATAAGCCAGG + Exonic
916284743 1:163093866-163093888 TTCTGTCCTTGTGATAAGGCAGG + Intergenic
916614226 1:166422992-166423014 CTCTGTCCTAGCAATAAGGCAGG + Intergenic
917444870 1:175098661-175098683 CTCTGACCTTGGCATAAAGGGGG + Intronic
918813380 1:189150067-189150089 GTCTGTCCTTGTAATAAGGAAGG + Intergenic
919539102 1:198827349-198827371 CTCTGTCCTTCCAATAAGGCAGG - Intergenic
919993411 1:202725657-202725679 GTCTTTCCTTGCCATAGTGCTGG - Exonic
920099564 1:203508475-203508497 CTCTGTCCTGGCCAGAAGGAAGG - Intronic
920897763 1:210074921-210074943 CTCTGTCCTTGCGATAAGGCAGG - Intronic
920952408 1:210584845-210584867 CTTTGTTCTTGCTATAAGGATGG - Intronic
920959849 1:210654698-210654720 CTCTGTTCTTGCCATTTGGCTGG - Intronic
921116132 1:212093365-212093387 CTCTGTCCTTGCGATAAGGCAGG - Intronic
921893847 1:220379204-220379226 CTCTGTCCTTGCGATAAGACAGG - Intergenic
922370973 1:224910307-224910329 CTCTGCCCTTGCAGTAATGCAGG + Intronic
922730656 1:227947450-227947472 CCGTGTCCTTGCCAAAAGGCTGG - Intronic
923109905 1:230882394-230882416 CTCTGTCCTGGCGATAAGGCAGG - Intergenic
924457532 1:244230615-244230637 CTCTGTCCTTAAAATAGGGCTGG + Intergenic
924697777 1:246418531-246418553 CTTTGTCCTTGTGATAAGGAAGG - Intronic
1063357726 10:5416919-5416941 CCCTGTCCTTGAAATAAGGCAGG - Intronic
1065371536 10:24991774-24991796 CTCTGTCCTTGTCATAAGGCAGG + Intronic
1065778320 10:29143115-29143137 CTCTGTCCTTCTGATAAGGAAGG + Intergenic
1066212359 10:33252342-33252364 CTCTGTCCTTGTGATAAGGAAGG + Intronic
1068258354 10:54543277-54543299 CTCTGTCCTTGTGATAAGGAAGG + Intronic
1068607945 10:59026408-59026430 CTCTGTCCTTGAGATAAGGAAGG + Intergenic
1069352944 10:67551509-67551531 CCCTGTCCTTGAGATAAGGCAGG + Intronic
1070139151 10:73724084-73724106 CTTTTTCCTTGCTCTAAGGCTGG - Intergenic
1070284303 10:75072177-75072199 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
1071353198 10:84767292-84767314 CTCTGTCCTTGTGACAAGGAAGG - Intergenic
1074490542 10:113935663-113935685 CTCTGTCCTTATAAGAAGGCTGG - Intergenic
1074803637 10:117026811-117026833 CTCTGTCCTTTCCTTCAGGATGG - Intronic
1077471111 11:2761001-2761023 CTCTGCCCTTGCCGTAAGGCAGG - Intronic
1077586647 11:3459056-3459078 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
1078113903 11:8426044-8426066 CTCTGTCCTTGTGATGAGGCAGG - Intronic
1078224462 11:9379488-9379510 CTCTGTCCTTGCAACAAGGTAGG + Intergenic
1078509631 11:11975785-11975807 CGCTGCACTTGCCATAATGCTGG + Intronic
1079989851 11:27235013-27235035 TTATGTGCTTGCCATAGGGCTGG + Intergenic
1081061374 11:38481831-38481853 CTCCGTCCTTGTGATAAGGAAGG + Intergenic
1081279230 11:41187647-41187669 CTCTGTCCTTGCAGTAAGGCAGG + Intronic
1081330014 11:41790882-41790904 CTCTGTCCTTGATATAAGGCAGG + Intergenic
1081352115 11:42066534-42066556 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1084188013 11:67485381-67485403 CTCTGTCCTTGTGATAAGGAAGG - Intronic
1084242646 11:67833088-67833110 TTCTGTCCTTGCAATAAGGCGGG - Intergenic
1084396533 11:68914593-68914615 CTCTGTCCTTGTGACAAGGAAGG - Intronic
1084830359 11:71763916-71763938 CTCTGTCCTTGCAATAAGGCGGG + Intergenic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1085410311 11:76286964-76286986 CCCTGGCCTTGCTCTAAGGCTGG - Intergenic
1086395680 11:86412950-86412972 CTCTCTCCTTGTGATAAGACAGG - Intronic
1087261159 11:96013911-96013933 CTCTGTCCTTGTGATAAGGAAGG + Intronic
1087335505 11:96839470-96839492 CTCTGTTTTAGCCATAAGGCAGG - Intergenic
1087781897 11:102310183-102310205 CTCTGTCTTTGCGATAAGCCAGG + Intergenic
1087788703 11:102384606-102384628 CTCTGTCCTTGAGATAAGGCAGG - Intergenic
1087816497 11:102664374-102664396 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1088103256 11:106177358-106177380 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
1088238507 11:107750276-107750298 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1088484153 11:110325096-110325118 CTCTGTCCTTGCAGTAAGGCAGG - Intergenic
1088507282 11:110539161-110539183 CTCCGTCCTTGCGATAAGGCAGG - Intergenic
1089122144 11:116144976-116144998 CTCTGTCCTTTCAATAAGGCAGG + Intergenic
1092384552 12:8026234-8026256 CCCTGTCCTTGTCTAAAGGCAGG + Intergenic
1092412875 12:8267789-8267811 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
1092470341 12:8772802-8772824 CTTTGGCCTTGCCAAAAGGAAGG - Intronic
1092570005 12:9710980-9711002 CACTGTCCTTGTGATAAGGCAGG + Intergenic
1092595891 12:10004253-10004275 CTCTGCCCTTGAGAAAAGGCCGG - Intronic
1092598650 12:10034884-10034906 CTCTGTCCTTGCTATAAGGTAGG - Intronic
1093654378 12:21677684-21677706 TTCTGTCCTTGAGATAAGGCAGG + Intronic
1093713351 12:22353237-22353259 ATCTGTCCTTCTCATAATGCAGG - Intronic
1094249265 12:28340831-28340853 CTCTGTCCTTGCCATAGGCAGGG - Intronic
1095234261 12:39777913-39777935 CTCTGTCCCTGCAGTAAGGCAGG + Intronic
1095641875 12:44495052-44495074 CTCTGTCCTTATGATAAGGCAGG - Intergenic
1095898592 12:47305346-47305368 CTCTGTCCTTGTGATAACGAAGG - Intergenic
1096171687 12:49476477-49476499 CTCTGTCCCTGTGATAAGACAGG + Intronic
1098571510 12:71992616-71992638 CTCTGTCTTTGCCAAAAGTGTGG + Intronic
1098930726 12:76409241-76409263 CTCTGACCTTGCCCTGAAGCAGG + Intronic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1099271203 12:80513126-80513148 CTCTGTCCTTGCGATAAGGCAGG - Intronic
1099460003 12:82910519-82910541 CTCTGTCCTTGTGATAAGGAAGG - Intronic
1100640531 12:96478259-96478281 CTCTGTGCTTACAACAAGGCAGG - Intergenic
1100641318 12:96484549-96484571 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
1101455204 12:104824593-104824615 CTCTGTCCTTGCGATAAGGCAGG + Intronic
1101455781 12:104828421-104828443 GTCTGTCCTTGCAATAAGGCAGG + Intronic
1102086902 12:110149485-110149507 CTCTGTCCTTGTGATAAGGTAGG - Intronic
1104088916 12:125498198-125498220 CTATGTCCTGGTCAGAAGGCTGG + Intronic
1104791433 12:131484365-131484387 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
1105594970 13:21828464-21828486 CTCTGTTCTTGGGATAAGGAAGG + Intergenic
1105673401 13:22644373-22644395 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1105682613 13:22744917-22744939 CTCTGTAGTTGCAATAAGGCAGG - Intergenic
1105724424 13:23147646-23147668 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1105728265 13:23186784-23186806 CTCTGCCTTTGCCATAAGGTGGG + Intronic
1106169881 13:27279888-27279910 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
1106319475 13:28624458-28624480 CTCTGTCGTTGTGGTAAGGCAGG + Intergenic
1106467647 13:30026920-30026942 CTCTGTCTTTGCCTAAAAGCAGG + Intergenic
1109172859 13:59117827-59117849 CTTTGTCATTGCCATAAGGCAGG - Intergenic
1109735952 13:66484191-66484213 CTCTGTCCTTGTGACAAGGAAGG + Intronic
1111156768 13:84337998-84338020 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1111198027 13:84898703-84898725 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1111217248 13:85159908-85159930 CTCTCTTCTTGAGATAAGGCAGG + Intergenic
1111355965 13:87102987-87103009 CACTGCCCTTGCGATAAGGCAGG + Intergenic
1112813808 13:103250036-103250058 TGCTGTCCTTGCGAAAAGGCAGG - Intergenic
1112814114 13:103252013-103252035 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1114891607 14:26931632-26931654 CTCAGTCCTTGCCATACTTCAGG + Intergenic
1115979106 14:39030128-39030150 CTCTGTCCTTGAGATAAGGCAGG - Intergenic
1116231842 14:42228570-42228592 CTCTGTCATTGCCACTAGGAAGG - Intergenic
1118667423 14:68086023-68086045 CTCTGTCCTTGAGATAAGGAAGG - Intronic
1119390490 14:74288236-74288258 CTCTGTCCTTGCCACCAAGTTGG + Exonic
1119697641 14:76726398-76726420 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
1120744721 14:88143013-88143035 CTCTGTCCATGTGATAAGGCAGG + Intergenic
1120745303 14:88146565-88146587 CTCTGTCCTTGGGATAAGGCAGG + Intergenic
1122034559 14:98937930-98937952 CTCTGTCTTCCCCATCAGGCTGG + Intergenic
1122436402 14:101704031-101704053 CTGTGTCCTTGTCATAAATCAGG - Intergenic
1124785564 15:32676495-32676517 CACTGTGCTTGCTATAGGGCAGG - Intronic
1126475631 15:49062819-49062841 CTCTGTTCTTGCCATAAGGCAGG - Intergenic
1126982004 15:54255204-54255226 CTCTGTCCTTGCGATAAGGGAGG - Intronic
1127498714 15:59536461-59536483 CTCGGTTCTTGCCTTAAAGCGGG - Intergenic
1128046043 15:64618475-64618497 CTCTGTTCTTGTGATAAGGCAGG - Intronic
1128735979 15:70054260-70054282 CTCTGTCCCTCGCATAAGGCAGG + Intronic
1128762535 15:70227197-70227219 CTCTGCCCTTGACAGGAGGCAGG - Intergenic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1133354085 16:5123294-5123316 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
1134346629 16:13397796-13397818 CTCTGTCTTTGTGATAAAGCAGG - Intergenic
1134535978 16:15027455-15027477 CTCTGTCCTTGTGATAAGGAAGG - Intronic
1137853846 16:51773510-51773532 CTCTGTCCTTGTGATAAAGAAGG + Intergenic
1138128307 16:54456851-54456873 CCCTGCCCTTGCGATAAGGCAGG - Intergenic
1138258139 16:55588154-55588176 CACTGTGCTTTCCATAAGGCAGG - Intergenic
1139351244 16:66337405-66337427 GGCTCTCCTGGCCATAAGGCAGG + Intergenic
1139860079 16:70013332-70013354 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
1139939004 16:70591355-70591377 CTCTGTCCTAGCTATAAGCGTGG - Intronic
1142955951 17:3522196-3522218 CTCTATCATAGCCATATGGCAGG + Intronic
1143290226 17:5822655-5822677 CTCTGTCCTTGTGATAAAGCAGG - Intronic
1143292338 17:5840825-5840847 CTCTGTCCTTCTGATAAGGAAGG - Intronic
1143973592 17:10813621-10813643 CTCTGTCCCAGCCACACGGCAGG - Intergenic
1144580263 17:16454960-16454982 CTCTGTCCCCGCCCTCAGGCTGG + Intronic
1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1148195329 17:45708934-45708956 CTGTGCCCTTGCCTTGAGGCTGG - Intergenic
1152335259 17:79697006-79697028 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
1153089862 18:1331191-1331213 CTCTGTCCTTTCCATGATGGAGG - Intergenic
1153710512 18:7794194-7794216 CTCTGTCCTTGTGATAGGGCAGG + Intronic
1153713086 18:7819655-7819677 CTCTGTCCTTGCAGTAAGGCAGG + Intronic
1156918022 18:42484468-42484490 CTCTCTCCTTTACATAATGCAGG - Intergenic
1157534955 18:48451335-48451357 CTCTGTCCTTGAGATAAGGCAGG - Intergenic
1158128261 18:54125559-54125581 CTCTGGGCCTGCCATATGGCAGG + Intergenic
1159305489 18:66636470-66636492 CTCTGTCCCTCCCATAACGTGGG + Intergenic
1159721648 18:71898883-71898905 CTTTGTCCTTGCGATAAGGCAGG - Intergenic
1160379332 18:78439629-78439651 CTTTGTCCTGGCCCTAAGGGTGG - Intergenic
1162637827 19:11984341-11984363 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1165295806 19:34925243-34925265 CTCTGTCCTTGCGATAACGCAGG - Intergenic
1165543071 19:36508233-36508255 CTCTGTCCTGTCCACCAGGCTGG - Intergenic
1166530479 19:43540179-43540201 CTCAGTCCTAGCCCTTAGGCTGG - Intergenic
1167748262 19:51365491-51365513 GTCTGTCCTTCCCATCAGCCTGG - Intronic
1168178925 19:54646367-54646389 GTCTGTCCTTGCAGGAAGGCAGG - Intronic
925424781 2:3739767-3739789 CTTTGTTCTTGCAACAAGGCAGG + Intronic
926139285 2:10358857-10358879 CTCTGTCCTTATGATAAGGCAGG + Intronic
927584036 2:24282511-24282533 TTCTGTCCTTGTGATAAGGAAGG + Intronic
928537898 2:32257970-32257992 CTCTGTCCTTGCAATAAGGCAGG - Intronic
928819360 2:35342320-35342342 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
929949025 2:46392359-46392381 CTCATTGCTTGCCAGAAGGCAGG + Intergenic
930763666 2:55062286-55062308 CTCTGTCCTTGCAATAAGGCAGG + Intronic
931034728 2:58227307-58227329 CTTTGTCCTTGCAATAAGGCAGG - Intronic
931470144 2:62531519-62531541 CTCTGCCCTTGTGATAAGGCAGG - Intergenic
932427115 2:71645151-71645173 CTCTGTGCTTGTGATAAGGCAGG - Intronic
932576561 2:72965449-72965471 CTCTGTCCTCGCGATAAGGCAGG + Intronic
932931471 2:76044862-76044884 CTCTGTCCTTGAGATAAGGCAGG - Intergenic
933187149 2:79290874-79290896 CTCTGTCCTTGTGATAAGGCAGG + Intronic
933315242 2:80706947-80706969 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
933466486 2:82658325-82658347 TTCCGTCCTTGTGATAAGGCTGG + Intergenic
934957087 2:98631807-98631829 TTCTGTCCTTGTGATAAGGCAGG + Intronic
934969844 2:98754488-98754510 GTCTGTCCTTCCCTTGAGGCAGG - Intergenic
935783617 2:106529825-106529847 CTCTGTCTTTGCCATCACACAGG + Intergenic
936269699 2:111040482-111040504 CACAGTCCTTGGCACAAGGCAGG - Intronic
937204194 2:120225166-120225188 CTCTGTCTTTGCCACAAAGATGG - Intergenic
937363903 2:121247112-121247134 CTCTGTCCACTCCATCAGGCCGG + Intronic
937820739 2:126307951-126307973 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
938030261 2:127986142-127986164 CTCTGTCCTTGCCATAAGGCAGG + Intronic
938960404 2:136335669-136335691 GTCACTCCTTGCCATAGGGCTGG + Intergenic
938980514 2:136521945-136521967 CTCTTTCCTTGTCAACAGGCTGG - Intergenic
940360511 2:152791244-152791266 CTCTGTCCTTGAGATAAGGCAGG + Intergenic
940478058 2:154191889-154191911 CTCTGTGCTTGCTGTAAGGCGGG - Intronic
940599913 2:155845630-155845652 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
941106819 2:161363948-161363970 CTCTGTCCTTGCAGTAAGGCAGG - Intronic
941325521 2:164109470-164109492 GTCTGTGCTTGCGATAAGGCAGG + Intergenic
941974417 2:171387127-171387149 ATCTGTCTTTACGATAAGGCAGG + Intronic
942204673 2:173608409-173608431 TTCTCTCCTTGGCATAAGGCAGG + Intergenic
944728330 2:202495153-202495175 CTCTGTCCTTGTGATAAGGAAGG - Intronic
947979397 2:234396143-234396165 CTCTGTGCTTGGCGTGAGGCTGG - Intergenic
1169399871 20:5270753-5270775 TTCTGTCCTTGGAATAAAGCAGG + Intergenic
1169663390 20:8005985-8006007 CTCTGTCCCTGTGATAAGGCAGG + Intronic
1170243572 20:14195922-14195944 CTCTGTCCCTACGATAAGGCAGG + Intronic
1170485956 20:16816560-16816582 CTCTGTCCTTGAGATAAGGCAGG - Intergenic
1171517540 20:25750095-25750117 CTCTGTCCTTCCAATAAAGCAGG - Intergenic
1171531729 20:25857676-25857698 CTCTGCCTTTGTCATGAGGCCGG - Intronic
1171564167 20:26163141-26163163 CTCTGTCCTTGCAGCAAGGTAGG - Intergenic
1171936345 20:31278385-31278407 CTCTGTACTTCCCATAACACTGG - Intergenic
1172021818 20:31919970-31919992 CTCTGACCTTGCCAGCAGGAGGG + Intronic
1172167767 20:32909325-32909347 CTCTGTTCATGACAAAAGGCAGG - Intronic
1172585151 20:36078023-36078045 CTCTGTCCTTGTGGTAAGGAAGG - Intergenic
1173421645 20:42906508-42906530 CTCTGTCCTTGCAATAAGGCAGG + Intronic
1173824868 20:46041675-46041697 TTCTGTCCTTGGCATCAGGGAGG + Intronic
1174376295 20:50128817-50128839 CTGTCTCCTTGGGATAAGGCTGG - Intronic
1176092656 20:63325869-63325891 CTGTGGCCTGGCCAGAAGGCTGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176737241 21:10561812-10561834 CTGTGTCCTTGCCTTCAGGATGG - Intronic
1177264504 21:18765246-18765268 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
1177339546 21:19782286-19782308 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1177564090 21:22796075-22796097 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1178810578 21:35877706-35877728 CTCTGTCCTTGCTGTGTGGCTGG + Intronic
1179246581 21:39638624-39638646 CTCTGTCCTTGAGATAAGGCAGG + Intronic
1179264299 21:39789069-39789091 CTCTTCCCTTGCCCTAAGTCAGG - Intronic
1179342303 21:40523708-40523730 CTCTGTCTTTGTGATAAGGCAGG + Intronic
1179381569 21:40903791-40903813 CTTAGTCCTTGCCACATGGCCGG - Intergenic
1180131767 21:45831168-45831190 GTCTGTCCAGGCCATGAGGCTGG + Intronic
1181040630 22:20190924-20190946 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1181043977 22:20205934-20205956 CTCTGTCCTTGTTATAAGGCAGG - Intergenic
1181050486 22:20236036-20236058 ATCTGTCCTTGCGATAAGGCAGG + Intergenic
1182168746 22:28204924-28204946 CCCTGTCCTTGTCTTAAAGCTGG + Intronic
1183106856 22:35621115-35621137 CTCTGCCCTGGCCATAATGAAGG - Intronic
1184453415 22:44596198-44596220 ATCTCTCCTTGCCAGAAGTCGGG + Intergenic
1184586921 22:45454168-45454190 ATCTGTCCTTTCCAAATGGCTGG + Intergenic
1184934102 22:47706471-47706493 CTGTGTCCTTGTGATAAGGAAGG - Intergenic
949828288 3:8185921-8185943 CTCTGTCATTGCGATAAGGCAGG - Intergenic
951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG + Intronic
951904381 3:27689186-27689208 CTCTGTCCTTCCCCTCAGGGTGG - Intergenic
952298760 3:32085509-32085531 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
952384100 3:32826790-32826812 CTCTGTCCTGTCCCTGAGGCTGG + Intronic
954364192 3:50137655-50137677 GCCTGTCCTTGCCATAGGGGTGG - Intergenic
955480594 3:59385558-59385580 CTCTGTCCTTGTGATAAGACAGG + Intergenic
956194136 3:66635220-66635242 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
956705656 3:71996702-71996724 CTCTGACCTTTCCCTGAGGCAGG + Intergenic
956778639 3:72587293-72587315 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
957057985 3:75458981-75459003 CTCTGTCTTTGCAATAAGGCGGG - Intergenic
957920630 3:86743619-86743641 CTCTCTCCTTCCCAGAAGCCAGG + Intergenic
958669057 3:97179960-97179982 CTGTTTCCTTGCCTTAAGGTTGG + Intronic
959583458 3:108004590-108004612 TTCTGTCCTTGTGATAAGGCAGG + Intergenic
959884641 3:111485353-111485375 CTCTGTCCTTGTTAGAATGCAGG - Intronic
960062801 3:113340768-113340790 CTCTGTCCTTGTGATAAGGAAGG - Intronic
960515208 3:118595637-118595659 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
961014912 3:123460161-123460183 CTCTCTCCTTGGCAACAGGCTGG + Intergenic
961295463 3:125880734-125880756 CTCTGTCTTTGCAATAAGGTGGG + Intergenic
961376027 3:126466431-126466453 CTCTGTCCTTGCCAGTAGCCAGG - Intronic
961890436 3:130126442-130126464 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
962095077 3:132285033-132285055 CTCTGTCCCTGCGATAAGGCAGG - Intronic
964308005 3:155361557-155361579 TTCTGTCCTTGCGATAAGGCAGG - Intergenic
964726239 3:159817037-159817059 GTCTATCTTTGCCTTAAGGCTGG + Intronic
965433050 3:168612725-168612747 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
966312960 3:178615340-178615362 CTCTGTCCTTCCCTTCAGGATGG + Intronic
967150160 3:186640934-186640956 CTTTGGCTTTGCCATAAAGCAGG + Intronic
969448599 4:7259914-7259936 CTCTGTCCTGCCCAACAGGCTGG - Intronic
969752178 4:9119678-9119700 TTCTGTCCTTGCAATAAGACGGG + Intergenic
970054627 4:11957085-11957107 CTCTATCCTTGCGATAAGGCAGG - Intergenic
970234464 4:13944633-13944655 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
970576675 4:17435575-17435597 CTCTGTTCTTGTGATAAGGCAGG - Intergenic
970697540 4:18696080-18696102 CTCTGTCCTTGCAATAAGTCAGG - Intergenic
971585631 4:28402602-28402624 CTCTGTCCTTGTGAAAAGGAAGG - Intronic
972307074 4:37841314-37841336 CTCAGTCCTTACCATCAGGTAGG + Intronic
972394833 4:38649828-38649850 CTCTGTCCTTGCAATAACGCAGG + Intergenic
972918460 4:43907289-43907311 CTCTGTCTTTGCTATAAGGCAGG + Intergenic
973057425 4:45678679-45678701 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
973936279 4:55850082-55850104 CCCTCTCCTTGCAATTAGGCAGG - Intergenic
974012256 4:56617699-56617721 CTCTGTCCTTGTGATAAGGAAGG - Intergenic
974250076 4:59374768-59374790 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974250615 4:59378552-59378574 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974850257 4:67395772-67395794 CTCTGACCTTCCCATGAAGCAGG + Intergenic
975208949 4:71676863-71676885 CTCTAGCCTTGCCACGAGGCTGG - Intergenic
976070616 4:81235947-81235969 CTCTGTCCTTGTGATAAGAAAGG - Intergenic
976913468 4:90339272-90339294 CTCTGTCATTGCCATATGTCGGG + Intronic
977718319 4:100209127-100209149 CTCTGTCCTCCCCAGAAGTCAGG - Intergenic
978503258 4:109432049-109432071 CTCTGACCTTCCCATGAAGCAGG - Intergenic
979275768 4:118812782-118812804 CTCTGTCCTTGTGATAAGGAAGG + Intronic
979862110 4:125707186-125707208 CTGTGTCCTTGTGATAAGGAAGG - Intergenic
980485466 4:133451268-133451290 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
980682597 4:136183875-136183897 CTCTGTCCTTGGGGTAAGGCAGG - Intergenic
981317191 4:143351163-143351185 CTCTGTCCTTGTGATAAGGGAGG - Intronic
981747657 4:148067040-148067062 TTCTGTCCCTCCCCTAAGGCTGG + Intronic
982004215 4:151049116-151049138 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
982300724 4:153876797-153876819 CTCAGTCCTTGTCATAGGGGAGG + Intergenic
982315133 4:154024118-154024140 CTCTGTTCTTGTGATAAGGCAGG + Intergenic
982504453 4:156199037-156199059 GTCTGTCCTTGTGATAAGGAAGG + Intergenic
984261273 4:177445469-177445491 CTCTGTCTTTGCGATAAGGCAGG + Intergenic
985253026 4:188042265-188042287 CTCTCTCCTTGCGATAAGGAAGG + Intergenic
985273784 4:188218765-188218787 CTCTGTCCTTGCGATAAGGAAGG - Intergenic
986364743 5:7019170-7019192 CTCTGTCTTTGTGTTAAGGCAGG - Intergenic
986365304 5:7022908-7022930 CTCTGTCCTTGTGATAATGCAGG - Intergenic
987005731 5:13707392-13707414 CTCTGTCCTTGCGATAAAGAGGG + Intronic
987182834 5:15385360-15385382 CTCTGCCCTTGTGATAACGCAGG - Intergenic
987398009 5:17443709-17443731 CTCTGTCCTTGAGATAAGCCAGG + Intergenic
988267249 5:28967843-28967865 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
988557501 5:32250322-32250344 CTCTGTCCTTGCTCTCTGGCTGG - Intronic
989204478 5:38797600-38797622 CTCTGTCCTTGTGATAAGGAAGG - Intergenic
990585521 5:57207596-57207618 CTCTGTCCTTGCGATAAGGCAGG - Intronic
990985048 5:61633501-61633523 GTCTGTTCTTGTTATAAGGCTGG - Intergenic
992038206 5:72802599-72802621 CTCTGTCTTTGCGATAAGGCAGG + Intergenic
992587245 5:78252806-78252828 CTGTGTCCTTCCCTTAAGGGTGG - Intronic
994301897 5:98157342-98157364 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
994871180 5:105351739-105351761 CTCTGTCCTTACAATAAGGCAGG - Intergenic
994884973 5:105548942-105548964 CTCTGTCCTTGTGATAAGGAAGG - Intergenic
995724804 5:115170793-115170815 CTCTGTCCTGGCCCTCAGGAAGG - Intronic
995979035 5:118078979-118079001 CTCTGTCCTTGCAGTAAGGCAGG + Intergenic
996936534 5:128955888-128955910 CTCTCTCCTGGCCATCAGGAAGG - Intronic
999007272 5:147996675-147996697 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
1001181174 5:169522019-169522041 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1002271365 5:178074663-178074685 CTTTGTTCTTGTGATAAGGCAGG + Intergenic
1003069905 6:2937931-2937953 CTCTGTCCTTGCGATAAGGTAGG - Intergenic
1003131243 6:3396926-3396948 CTGTGTCCTTGCAATAAGGCAGG + Intronic
1003499763 6:6694708-6694730 CTCTGTCCTTGGAATAAGGCAGG - Intergenic
1003683344 6:8277478-8277500 CTCTGTTCTTCCCAAAATGCTGG - Intergenic
1003952242 6:11127203-11127225 TTCTGTCCTTCCCATTAGGGTGG + Intronic
1004927988 6:20434127-20434149 CTCTGTCCCTCCCACAAGGCAGG - Intronic
1005660897 6:27998578-27998600 CTCTGTCCTTGTGATAAGGAAGG - Intergenic
1005712226 6:28513244-28513266 CTCTGTCTTTGTGATAAGGCAGG + Intronic
1007307598 6:40919042-40919064 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1007854923 6:44845915-44845937 CTCTGTCCTTGCGATAAGGCAGG + Intronic
1008727639 6:54441574-54441596 CTCTATCCTTGCAATAAGACAGG - Intergenic
1009762717 6:68028504-68028526 CTCTGTCCCTGCCCTTAGGTAGG + Intergenic
1010503969 6:76633616-76633638 CTCTGTCCTTGAGATAAGGCAGG - Intergenic
1011083192 6:83511701-83511723 CTCGGTCCTGGCCCTAAAGCAGG - Intergenic
1011325705 6:86148553-86148575 CTCTGTCTTTGTGATAAGGAAGG - Intergenic
1011326296 6:86152410-86152432 CTCTGTCCTTGTGATAAGGAAGG - Intergenic
1011734683 6:90298341-90298363 CTCTGTCCTTGCCAGGGGTCAGG - Intergenic
1011801624 6:91022303-91022325 CTCTGTCTTTGCCGTATGGCAGG + Intergenic
1012072450 6:94640024-94640046 CTCTGTCCTTTCTCTAAGGCAGG + Intergenic
1012374995 6:98551249-98551271 CTATCTCCTTGCCTTGAGGCAGG + Intergenic
1013400316 6:109788812-109788834 CAGTGTCCTTGCCAGAAGCCAGG + Intronic
1014247222 6:119081549-119081571 CTCTGTCCTTGTGATAAGGCAGG - Intronic
1014323823 6:119966518-119966540 CTCTGTCCTTGTGGTAAGGCAGG + Intergenic
1014447613 6:121546947-121546969 CTCTGTCCTTGGGATAAGGTGGG - Intergenic
1014717991 6:124887925-124887947 TTCTGTCCTTGTGATAAGGAGGG + Intergenic
1014833816 6:126134563-126134585 ATCTGTCCTTGCCAAAAGCGGGG - Intergenic
1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1015959526 6:138632297-138632319 CTGTGTCCTTGCCTTCAGGGTGG - Intronic
1017236364 6:152120816-152120838 GTCTGTGCTTTCCATAATGCAGG - Intronic
1017632098 6:156406300-156406322 CTGTGTCTTTTCCATAAGCCGGG - Intergenic
1017708455 6:157146127-157146149 GTCTGCCCTTGCCATTAAGCCGG + Intronic
1018258019 6:161941564-161941586 CTCTGTCTTTGTGATAAGGCAGG + Intronic
1019664134 7:2242884-2242906 CTCTGTCCTTGCGATAAGGCAGG - Intronic
1019811060 7:3165432-3165454 CTCTGTCCATGAGAGAAGGCTGG + Intronic
1022877065 7:34544984-34545006 CTCTGTCCTTGCAAGAAGGTAGG + Intergenic
1023253614 7:38291132-38291154 CTCCGTCCTTGCAATAAGGCAGG + Intergenic
1023307780 7:38849375-38849397 CTTTGTCCTTGCTATAAAGCAGG - Intronic
1023703293 7:42913175-42913197 CTCTGCCCCTCCCATAATGCAGG + Intronic
1024268106 7:47621963-47621985 CTCTGTCCGTGTGATAAGGAAGG - Intergenic
1025085158 7:56017750-56017772 CTCTGTCTCTGTCATCAGGCTGG + Intronic
1025273556 7:57551075-57551097 CTCTGTCCTTGCAGCAAGGTAGG + Intergenic
1026382520 7:69813783-69813805 CCCTGTGCTTGGCATATGGCAGG + Intronic
1026572467 7:71543392-71543414 CTCTGTGCTGGCTTTAAGGCAGG + Intronic
1026892685 7:73991778-73991800 CTCTGTCCCAGCCATGAGGAGGG - Intergenic
1027932299 7:84552913-84552935 CTCTGTCCTTGTGATAAGGAAGG + Intergenic
1029836570 7:103318440-103318462 CTCTGTCCTTCCTTTCAGGCTGG + Intronic
1030101818 7:105953334-105953356 ATCTGCCCTTGTGATAAGGCAGG + Intronic
1030769537 7:113457007-113457029 CTTTGTCCTTGCGACAAGGTAGG + Intergenic
1031219465 7:118946053-118946075 CTTTGTCCTTGCGACAAGGCAGG + Intergenic
1032691730 7:134294276-134294298 CTCTTTCCTTCCCAAAACGCTGG + Exonic
1033418481 7:141185243-141185265 CTCTGTCCTGGAGATAAGGCAGG - Intronic
1033970593 7:147034554-147034576 CTCTGTCCTTGCAGTAAGGCAGG - Intronic
1034071560 7:148190836-148190858 CTCTGTCTTTCCCCTAGGGCTGG - Intronic
1034227437 7:149494823-149494845 CACTGTCCTTGACACATGGCAGG + Intronic
1035339870 7:158153331-158153353 CTCTGTCCTTGTGATAAGGAAGG + Intronic
1036375392 8:8195082-8195104 CTCTCTCCTTGCAATAAGGCAGG + Intergenic
1036854142 8:12228066-12228088 CTCTCTCCTTGCAATAAGGCAGG - Intergenic
1036875512 8:12470566-12470588 CTCTCTCCTTGCAATAAGGCAGG - Intergenic
1038248616 8:25882059-25882081 CTCTGTCCTTGTGATAAGGCAGG + Intronic
1038329377 8:26596052-26596074 CTCTCTCCTTGCTTTAAGGATGG - Intronic
1039076221 8:33692884-33692906 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1039086292 8:33783471-33783493 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1039865659 8:41499353-41499375 CTCTGCCCTTGTGATAAGGCAGG - Intronic
1041044180 8:53876627-53876649 CTCTGTCCTTGCCAGAAGTTCGG + Intronic
1043238436 8:77899565-77899587 CTCTGTCCTTGTGATAAGAAAGG - Intergenic
1043605261 8:81991590-81991612 CTCTGTCTTTGTGATAAGGCAGG - Intergenic
1044085317 8:87936294-87936316 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1045938482 8:107710848-107710870 CTCTGTCCTTGTGATAACGAAGG - Intergenic
1045977434 8:108145854-108145876 CTCTCTTCTTGCCATAATGCTGG - Intergenic
1046138352 8:110060370-110060392 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1046138938 8:110064185-110064207 GTCTGTTCTTGCAATAAGGCAGG + Intergenic
1047202083 8:122775843-122775865 CTCTGTCCTTGTGATAAGGAAGG - Intergenic
1047640884 8:126820745-126820767 TTCTGTCCTTGCAATAAGGCAGG - Intergenic
1048082950 8:131148740-131148762 CCCTGTCCTGGAGATAAGGCAGG - Intergenic
1048133759 8:131725711-131725733 CTCTCTCCTTGACATCATGCAGG - Intergenic
1048135050 8:131740250-131740272 CTCTGTCTTTGCAATAAGGCAGG + Intergenic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1050784823 9:9387976-9387998 CTCTGTCCTTGTGATAAGGAAGG - Intronic
1050944549 9:11500714-11500736 CCCTGTCCTTGTGATAAGTCAGG - Intergenic
1051092309 9:13424352-13424374 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1051103559 9:13550824-13550846 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
1051886985 9:21903907-21903929 CTCTGTCCTTGTGATAAGAAAGG - Intronic
1052566510 9:30160390-30160412 TTCTGTCCTTGTGATAAGGCAGG - Intergenic
1053394616 9:37761899-37761921 CTCTGTCCTTTCCACCAGACTGG - Exonic
1055054357 9:72010415-72010437 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1055734480 9:79312671-79312693 CTCTATCCTTGCGATAAGGCAGG + Intergenic
1058311909 9:103514711-103514733 CTCTGTCCTTGTGATAAGAAAGG - Intergenic
1058464940 9:105217685-105217707 CTCTGTCCCTGCCATGACACAGG + Intergenic
1058664066 9:107293438-107293460 CTATGTACTTGCCATATGCCAGG - Intronic
1061144267 9:128787854-128787876 CTTTGTCCTTGCCTTCTGGCAGG + Intronic
1062651855 9:137581882-137581904 CTCTGTCCTTGTCTTGCGGCAGG - Intergenic
1203625244 Un_KI270750v1:11721-11743 CTCTGTCCTTGCAACATGGTAGG + Intergenic
1185549056 X:969011-969033 TTCTGTGCTTGCCAAAATGCTGG + Intergenic
1186286204 X:8046578-8046600 CTCTGCCCTTGCAATAAGGCAGG - Intergenic
1186387044 X:9120571-9120593 CTCTGGCCTTGCAATCATGCGGG - Intronic
1189959043 X:46307421-46307443 CTCTGTCGTTGCGATAAGGCAGG - Intergenic
1190619553 X:52271583-52271605 CTCTGTCCTCGCGATAAGGTAGG - Intergenic
1190735487 X:53253100-53253122 ATCTGGCCTTGCCATCAGCCTGG - Intronic
1191104581 X:56764542-56764564 CTCTGTTCCTGGCAGAAGGCAGG + Intergenic
1192748475 X:73963661-73963683 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1193192118 X:78583179-78583201 TTCTGTCTTTGCCACATGGCCGG - Intergenic
1193400468 X:81036495-81036517 CTCTGTCCCTGTGATAAGACAGG - Intergenic
1193416357 X:81229392-81229414 CTCTGTCCTTGTGATAAGGCAGG - Intronic
1194054122 X:89109945-89109967 CCCTGTCCTTGTGATAAGGAAGG - Intergenic
1194068242 X:89288249-89288271 CTCTGTGCTTGCGATAAAGCAGG - Intergenic
1194211253 X:91072229-91072251 CTCTGTCCTTGCGATAAGGGAGG - Intergenic
1194221645 X:91200500-91200522 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1194298318 X:92154937-92154959 CTCTGTCCTTATGATAAGGAAGG + Intronic
1194859588 X:98980172-98980194 CTCTATCTTTGTGATAAGGCAGG + Intergenic
1195367274 X:104138578-104138600 CTCTGTCCTTGCAATAAGGCAGG - Intronic
1196258865 X:113554604-113554626 CCCTGTCCTCGTGATAAGGCAGG - Intergenic
1196555295 X:117078256-117078278 GTCTGTCCTTCCCTTGAGGCGGG + Intergenic
1196869163 X:120096478-120096500 CTCTGCCCTTGCGATAAGGCAGG + Intergenic
1197459638 X:126724278-126724300 CTCTATCCTTACAATAAGGCAGG + Intergenic
1197567653 X:128107540-128107562 CTCAGTCCTTGACTTTAGGCTGG - Intergenic
1198167539 X:134072255-134072277 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1198235765 X:134734725-134734747 CTCTGTCCATGCTATAAATCAGG + Intronic
1198311668 X:135430838-135430860 CACTGTGCTTGCCACAGGGCTGG - Intergenic
1199142604 X:144331302-144331324 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1200558160 Y:4664256-4664278 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1200615926 Y:5379897-5379919 CTCTGTCCTTATGATAAGGAAGG + Intronic
1200690358 Y:6302940-6302962 CTCTGTGTTTGCAGTAAGGCAGG - Intergenic
1200710107 Y:6475739-6475761 CTCTGTCCTTGCAGTAAGGCAGG - Intergenic
1200722385 Y:6622418-6622440 CTCTGTGCTTGCGATAAAGCAGG - Intergenic
1200883524 Y:8245473-8245495 TTCTGTCTTTGCCGTAAGGCAGG - Intergenic
1200910083 Y:8524105-8524127 CACTGTCTTTGCAGTAAGGCAGG + Intergenic
1200960224 Y:8989616-8989638 TTCTGTCTTTGCAGTAAGGCAGG + Intergenic
1200985251 Y:9296707-9296729 CTCTGTCCTTGCAGTAAGGCAGG - Intergenic
1201024008 Y:9688969-9688991 CTCTGTCCTTGCAGTAAGGCAGG + Intergenic
1201044915 Y:9871776-9871798 CTCTGTGTTTGCAGTAAGGCAGG + Intergenic
1202183569 Y:22159913-22159935 CTCTGTCTTTGCAGTAAGGCTGG - Intergenic
1202200031 Y:22336374-22336396 CACTGTCTTTGCAGTAAGGCAGG + Intronic
1202207790 Y:22426488-22426510 CTCTGTCTTTGCAGTAAGGCTGG + Intergenic