ID: 951553621

View in Genome Browser
Species Human (GRCh38)
Location 3:23899024-23899046
Sequence ATTTTTCCACAGATGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 5, 2: 29, 3: 153, 4: 555}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951553621_951553631 19 Left 951553621 3:23899024-23899046 CCCATCTCCATCTGTGGAAAAAT 0: 1
1: 5
2: 29
3: 153
4: 555
Right 951553631 3:23899066-23899088 CCCTGGTGCCAAAAAGACTGGGG 0: 19
1: 205
2: 1389
3: 1700
4: 1302
951553621_951553624 -5 Left 951553621 3:23899024-23899046 CCCATCTCCATCTGTGGAAAAAT 0: 1
1: 5
2: 29
3: 153
4: 555
Right 951553624 3:23899042-23899064 AAAATTGTCATCCACAAAACCGG 0: 7
1: 294
2: 616
3: 907
4: 1108
951553621_951553629 18 Left 951553621 3:23899024-23899046 CCCATCTCCATCTGTGGAAAAAT 0: 1
1: 5
2: 29
3: 153
4: 555
Right 951553629 3:23899065-23899087 TCCCTGGTGCCAAAAAGACTGGG 0: 18
1: 216
2: 1415
3: 1788
4: 1392
951553621_951553625 2 Left 951553621 3:23899024-23899046 CCCATCTCCATCTGTGGAAAAAT 0: 1
1: 5
2: 29
3: 153
4: 555
Right 951553625 3:23899049-23899071 TCATCCACAAAACCGGTCCCTGG 0: 4
1: 95
2: 651
3: 1084
4: 1607
951553621_951553628 17 Left 951553621 3:23899024-23899046 CCCATCTCCATCTGTGGAAAAAT 0: 1
1: 5
2: 29
3: 153
4: 555
Right 951553628 3:23899064-23899086 GTCCCTGGTGCCAAAAAGACTGG 0: 18
1: 215
2: 1387
3: 1853
4: 1379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951553621 Original CRISPR ATTTTTCCACAGATGGAGAT GGG (reversed) Intronic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
901895285 1:12306748-12306770 ATTTTTCCACAGACAGGGTTGGG + Intronic
902065991 1:13688086-13688108 TTTTTTCAACGGATGGAGTTGGG + Intergenic
902592736 1:17486637-17486659 ATTTTTCCACAGACTGAGTCGGG - Intergenic
903400881 1:23047062-23047084 ATTTTTCCTCTGAAAGAGATAGG + Intronic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
903842083 1:26250432-26250454 ATTTTTCCACAGACGATGGTTGG - Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906725348 1:48040304-48040326 ATGTTTGCACAGCTGGGGATGGG + Intergenic
906926406 1:50122321-50122343 ATTTTATCACAGCAGGAGATAGG + Intronic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
908068375 1:60432593-60432615 ATTTTTCTTCAGAGGGAGTTGGG - Intergenic
909961673 1:81853404-81853426 TTTTTCACACAGATGGATATAGG - Intronic
909993982 1:82256235-82256257 ATTTTTAAACAGATCGAAATTGG + Intergenic
910104885 1:83621341-83621363 ATTTGTCCACTGATGGAAACAGG - Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910687269 1:89930078-89930100 ATTTTTCCAGAAATGGGGGTTGG - Intronic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
911330022 1:96516332-96516354 TTTTTTCCCCTGAGGGAGATTGG + Intergenic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
911719730 1:101177819-101177841 ATTTTTCCACAGAGTGGGTTGGG - Intergenic
912269457 1:108194022-108194044 ATTTTCCTAAATATGGAGATTGG + Intronic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
915100095 1:153492990-153493012 CTTTTTCCACTGATGCAGCTTGG + Intergenic
915151983 1:153840823-153840845 AATATTTCAAAGATGGAGATAGG + Intronic
915254751 1:154618679-154618701 GTTATTCAACAGATGGAGCTGGG + Intronic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916317978 1:163471588-163471610 TTTTTTTTTCAGATGGAGATAGG - Intergenic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916908790 1:169321179-169321201 ATTTTGCTAGAGATGGAGTTTGG - Intronic
917134319 1:171774489-171774511 ATTTATCCATAGAGGGAGTTTGG - Intergenic
918234487 1:182566340-182566362 TCTTTTCCACAAATGGAGGTGGG - Intergenic
918401876 1:184171652-184171674 ATTTTTCCATAGCTGAAGACAGG - Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919996567 1:202757052-202757074 ATTTTTCCATGGATGGGGAAGGG + Intronic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
920990667 1:210936296-210936318 ATTTCTCTACACATGAAGATGGG - Intronic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922137791 1:222848857-222848879 ATTTTTCTAAATATGGGGATGGG + Intergenic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
923137521 1:231131415-231131437 AGATTTCAACAGATAGAGATGGG - Intergenic
924400956 1:243681098-243681120 ATTCTTTCAGAGATGGAGCTGGG - Intronic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063536270 10:6886676-6886698 ATATTTCCACGGATCGGGATGGG - Intergenic
1063609484 10:7551219-7551241 ATTTTTCCATCGATGGACTTTGG + Intergenic
1064178411 10:13095413-13095435 ATTTTTCCATGGATGGTGGTGGG + Intronic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064717603 10:18192884-18192906 ATTCATCCACTGATGGACATGGG + Intronic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065501443 10:26386824-26386846 AATGTTCCACAAATGCAGATTGG - Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1065960241 10:30728003-30728025 ATTTTTCCATGGATGGGGAGAGG + Intergenic
1066199465 10:33131279-33131301 ATTTTTCCACAGAGAGGGACAGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1066493280 10:35915744-35915766 ATTTTTCAAAATATGGAAATGGG - Intergenic
1067269362 10:44775868-44775890 ATTCTTCCAAAGCTGGAGGTTGG - Intergenic
1067314327 10:45147570-45147592 TTTTTTTCACAGATGGATCTAGG + Intergenic
1067415761 10:46101070-46101092 AATTTTCCACAAATGAAGCTGGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1067551313 10:47238410-47238432 ATGTTTCAACAGCTGAAGATTGG + Intergenic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068581100 10:58740794-58740816 ATTGTTCGCCAGATGGAGAAAGG + Intronic
1068765543 10:60759225-60759247 ATTTTTCCATGGATGGAGGTGGG + Intergenic
1068861791 10:61855169-61855191 ATTTTTCCACAGACGTAGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069280176 10:66645820-66645842 ATTTTTCCACGGATAGTGAGTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1070056634 10:72941324-72941346 ACTTTTCCCCAGATGGACTTGGG - Exonic
1070698248 10:78579044-78579066 ACTTGTCCACAGATGCAGAGAGG - Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072332696 10:94369233-94369255 ATTTTTCCACAGATCAGGGTGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073626314 10:105101418-105101440 ATTTTTCAAAACATAGAGATTGG - Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074124556 10:110517684-110517706 ATTTTCCCACAGACGGGGTTCGG - Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074959693 10:118431162-118431184 ATTTTTTTCCATATGGAGATTGG + Intergenic
1075290149 10:121222361-121222383 ATTTTTCCACGGATGTGGAGTGG - Intergenic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076476399 10:130756702-130756724 TTTTTGCAACAAATGGAGATGGG + Intergenic
1077505141 11:2926587-2926609 ATTTTTCCACGGATGTGGGTGGG + Intergenic
1077958259 11:7044665-7044687 ATCTTTCCTCAGATTTAGATGGG - Intronic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078681368 11:13479824-13479846 ATTGTTTCACAGATGGTGTTTGG + Intergenic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080282594 11:30575634-30575656 TTTTAACCACAGATAGAGATAGG + Intronic
1080470231 11:32538353-32538375 ATTTTTCCATGGATGGGGGTCGG + Intergenic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1080813318 11:35727817-35727839 ATTTTCCCACAGATACAGATGGG - Intronic
1081281182 11:41210840-41210862 ATTCTTCCACTGATGGGGGTTGG + Intronic
1081552564 11:44127554-44127576 ATTTTTCCACAGACTGGGTTTGG - Intronic
1081844385 11:46228834-46228856 ATTTATCAACTGATGGACATCGG - Intergenic
1082708842 11:56527915-56527937 ATTTTTCCATGGATGGGGGTTGG + Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083512213 11:63220446-63220468 ATTTTTCCAAAGACAGAGTTTGG - Intronic
1083576675 11:63796899-63796921 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085175050 11:74478542-74478564 ATTTTTCAATAGATGAAAATAGG - Intergenic
1085839733 11:79997880-79997902 ATTTCTCCACCTATTGAGATGGG - Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1087976333 11:104552293-104552315 TTTTTTTCACAGTTGGAGAAGGG - Intergenic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1089410671 11:118239395-118239417 ATTTTTCCAGTGAAGGAAATGGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1089938770 11:122393969-122393991 TTTGTTCCACAGTTGGAAATAGG + Intergenic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1090748061 11:129723078-129723100 TTTTTTCTAGAGAGGGAGATGGG + Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092734293 12:11565526-11565548 ATTTTCCCACGGATGGGGGTTGG - Intergenic
1093168766 12:15835732-15835754 GTTTTTCCATGGATGGAGTTGGG - Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094747644 12:33364114-33364136 ATTTTTCCACAGACTGGGATGGG - Intergenic
1095184064 12:39180425-39180447 ATTTTTCCATGGATGGGGAGGGG + Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1096879681 12:54657741-54657763 ATTTTTCCATACACGGAGCTGGG + Intergenic
1097110562 12:56655001-56655023 ATTTTTCCATGGATGGGGGTGGG - Intergenic
1097147884 12:56954152-56954174 ATATTTCCACACCAGGAGATGGG - Intronic
1097394711 12:59059672-59059694 ATTTTTTCACTGATGCAGATGGG + Intergenic
1097808868 12:63996067-63996089 CTTTTTTCACATATAGAGATTGG - Intronic
1097824636 12:64162431-64162453 ATTTTTCCACAGATGATAGTGGG - Intergenic
1098140465 12:67445446-67445468 ATTTTTCCACTGATGGGCAAGGG + Intergenic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1098817540 12:75186499-75186521 TTTTTACAACAGAAGGAGATGGG - Intronic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099517400 12:83614587-83614609 ATTTTGCCTAAGATGGAGAAGGG + Intergenic
1099775416 12:87121526-87121548 ATTTTACTCCAGATGGTGATAGG + Intergenic
1100053667 12:90482889-90482911 ATTTTCCCAAAGTTGGAGGTGGG + Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100372082 12:93977756-93977778 ACATTTAGACAGATGGAGATGGG + Intergenic
1100733641 12:97501773-97501795 ATTTCTCGACAGGTGGAGACAGG - Intergenic
1100804242 12:98264339-98264361 ATTTCTGCACAGAGGCAGATAGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1104065713 12:125304015-125304037 ATTTTTCCATAGACAGTGATGGG + Intronic
1104238927 12:126967902-126967924 ATTTTGCAGCAGATGTAGATTGG - Intergenic
1105570576 13:21599119-21599141 GTTTCTCCACTGATGGAGGTGGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106658335 13:31771485-31771507 ATTTTTCTATGGATGGAGAGGGG - Intronic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1107505977 13:41033739-41033761 ATTTTTCCACAGAAGTTGGTGGG - Intronic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1108583846 13:51850581-51850603 ATTTTTTCTCAGGTGGGGATAGG + Intergenic
1109490086 13:63086231-63086253 ATTTTTCTACAGACAGGGATGGG - Intergenic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1110616790 13:77550756-77550778 ATTCATCCACTGATGGACATTGG + Intronic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1111320964 13:86628359-86628381 ATTTTTCCATGGATGGTGAGTGG + Intergenic
1111423058 13:88042867-88042889 ATGTTTTCAGAGCTGGAGATTGG + Intergenic
1112245023 13:97725428-97725450 ACTTTTTCTCAGATTGAGATGGG - Intergenic
1112581392 13:100679183-100679205 ATTTTTCCATGGATGGAGTTGGG - Intergenic
1113182086 13:107641005-107641027 ATTTATCCATTGATGGACATAGG - Intronic
1113491397 13:110694882-110694904 ATTCTTCCACCGTTGGACATTGG - Intronic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1115486131 14:33913182-33913204 GTTCTTCCACTGATGGACATAGG + Intergenic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1117299772 14:54413165-54413187 CTTTTTCCATAGAGGAAGATGGG - Intronic
1117559130 14:56917930-56917952 ATTTTTCCATATATGGGGGTGGG + Intergenic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117768032 14:59103135-59103157 ATTTTTCCACAGATGACAGTGGG - Intergenic
1118513827 14:66505869-66505891 ATTTTTCCATGGATGGAGATGGG - Intergenic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119454434 14:74742514-74742536 GTTTTTCCACAGATGGCAGTGGG + Intergenic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120806277 14:88754387-88754409 ATTTGTCCAAAGGTGGAGGTGGG - Intronic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1121474604 14:94185787-94185809 TATTTTCCAAAAATGGAGATGGG - Intronic
1121644348 14:95507572-95507594 GTTTTTACCCAGATGGAGGTGGG + Intergenic
1122144002 14:99677996-99678018 ATTTTTCCATGGATGGGGGTTGG + Exonic
1122383453 14:101327320-101327342 ATTTTTCCTCATTTGCAGATGGG - Intergenic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1123009398 14:105340440-105340462 GTTTTTCCACAGACGGTGATGGG + Intronic
1123065054 14:105614490-105614512 ATTTTTCCACAGACCAAGATCGG - Intergenic
1123069254 14:105633925-105633947 ATTTTTCCACAGACCAGGATCGG - Intergenic
1123094302 14:105759085-105759107 ATTTTTCCACAGACCAGGATCGG - Intergenic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1124032216 15:26021877-26021899 TTTTTGCCATAGATGGACATTGG + Intergenic
1124164890 15:27317538-27317560 AGTTTTCCAAAGATGAGGATGGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1125549574 15:40535480-40535502 GTTTTTCCACATATTGAAATTGG + Intronic
1125744258 15:41988067-41988089 GTTTTTCCACAGGTGGACAAGGG - Exonic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1127475772 15:59331352-59331374 ATGTTTCCCCAGTTGTAGATGGG - Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130127289 15:81104674-81104696 ATTTTTCCACACTTTCAGATTGG - Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1131839420 15:96419778-96419800 ATTTATCCTCAGATGGTGTTCGG + Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1132198457 15:99931668-99931690 GTGTTTCCATAGATGGAGAGTGG + Intergenic
1133213290 16:4274746-4274768 GTTTTTCAACAAATAGAGATAGG + Intergenic
1133863704 16:9621390-9621412 ATTTTTCCACAGATCACGAAGGG + Intergenic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1135191405 16:20357728-20357750 ATTTTTCCAGGGATGGGGGTGGG + Intergenic
1135399795 16:22158593-22158615 ATTCTGCCACTGATGGACATTGG - Intergenic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1137366452 16:47863649-47863671 ATTTCTACACAGATGGGGAGTGG + Intergenic
1137399547 16:48142132-48142154 ATATTTACAGAGACGGAGATGGG + Intronic
1137681558 16:50350926-50350948 ATATTTCCACAGATGAGTATTGG + Intronic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1138739470 16:59291088-59291110 TTTTTTCCACTGCTGGAGAAAGG - Intergenic
1138957511 16:61989335-61989357 GTTTTCCCACACATGGAGACTGG + Intronic
1139021499 16:62755604-62755626 ATTTCTTTAGAGATGGAGATTGG + Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140358621 16:74326400-74326422 ATTTTTCCGCAGATTGGGACGGG + Intergenic
1140937022 16:79681898-79681920 ATTTTTCCAAACATGAAGAAAGG - Intergenic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1142824934 17:2504172-2504194 TTTATTACACAGATGGAGAGTGG + Intronic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1143516008 17:7419545-7419567 AATTTTCCATGGATGGAGGTAGG - Exonic
1143727668 17:8860489-8860511 ATTTTTCCACGGAAGGGGTTTGG - Intronic
1144450143 17:15370387-15370409 ATTTTTCCACGAATGGGGAGTGG + Intergenic
1144850399 17:18241236-18241258 ATTTTGTCACAGATCGAGAGAGG + Intronic
1146738118 17:35257101-35257123 ATTTTTTCACGGATGGGGGTTGG - Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1148251012 17:46080349-46080371 TTTTTTCCCCAAATGGAGGTAGG - Intronic
1148623026 17:49048898-49048920 TTTCTTCCACGGATGGAGGTGGG - Intronic
1149231865 17:54544379-54544401 ATTTTTCCCCTGCTGGAGCTGGG + Intergenic
1149588285 17:57808337-57808359 GTTTTTCCATGGATGGGGATGGG - Intergenic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1151573724 17:74940720-74940742 ATTTTTCCATGGATGGAGGGTGG - Intronic
1151836711 17:76586648-76586670 ATTTTTCCACGGAGGGGGGTGGG + Intronic
1151958962 17:77394984-77395006 GTTTTTCCAGAGGTGGGGATGGG + Intronic
1152990360 18:358121-358143 ATTTTTCCATGGATGGACAGGGG - Intronic
1153350239 18:4072304-4072326 TTTTTTTCATAGATTGAGATTGG + Intronic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1155813225 18:30266837-30266859 TTTTTTCTCCAAATGGAGATAGG - Intergenic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1156053026 18:32961586-32961608 ATTTTTCCACAGACAGAGCAGGG + Intronic
1156530191 18:37807647-37807669 ATTTTTCCACAAGTGGAATTGGG + Intergenic
1156954419 18:42944110-42944132 TTTTTTCCACTGAAGGACATGGG - Intronic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157635438 18:49148870-49148892 ATTTTTCCACGGATGCAGGGTGG + Intronic
1158193221 18:54854896-54854918 ATTTTTTCACAGACTGGGATTGG + Intronic
1158530736 18:58257586-58257608 ATTTCTCCACAGCTGGAGACAGG - Intronic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1159405716 18:68000530-68000552 AGTTTTCAAGACATGGAGATGGG + Intergenic
1159937271 18:74379241-74379263 ATTTTTCCACAGACCAAGGTTGG + Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163780049 19:19241503-19241525 ATTTTTACACAGCGGGAGAAGGG - Intronic
1164252537 19:23493858-23493880 AATTTTCCACAGATGTATTTTGG - Intergenic
1164319261 19:24126063-24126085 AATTTTCCACAGATGTATTTTGG + Intronic
1164971209 19:32534230-32534252 ATTTGACCAAAGATGGAGAATGG + Intergenic
1165235835 19:34420893-34420915 ATTTTTTCACAGACTGAGGTGGG + Intronic
1165242478 19:34479903-34479925 ATTTTTCCACAGACAGGGATGGG - Intergenic
1165703505 19:37957025-37957047 TTTTTTCAACAAATGGAGCTGGG - Intronic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1166910448 19:46151330-46151352 ATTTTTCAACAAATGGTGCTGGG - Intronic
1167816378 19:51885068-51885090 AATTTTCCTCAGATGCACATAGG - Intronic
1167925900 19:52820985-52821007 ATTTTCCCAGAGCTGGAGCTGGG + Intronic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926177122 2:10603984-10604006 ATTTTTCCACGGATGCAGGGAGG + Intronic
926514544 2:13825423-13825445 ATTTTTGTACAGATGGATTTGGG - Intergenic
927259452 2:21072449-21072471 GTTTTTCCACGGATGGGGATCGG + Intergenic
927505112 2:23607823-23607845 ATTTTTCCATGGATGGGGCTGGG - Intronic
928252343 2:29692434-29692456 ATTTTTCCACGGATGGTTTTGGG + Intronic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929008302 2:37416526-37416548 ATTTTTCCACAAAGGGAGGGTGG - Intergenic
931025408 2:58108616-58108638 AGACTTCCACAGATGGAGACAGG - Intronic
931278572 2:60766663-60766685 TTTTTTAAACAGATGGAGACGGG - Intronic
931867783 2:66431084-66431106 ATCTTTCCAGAGATAGAGAACGG - Intergenic
932725367 2:74175384-74175406 ATTTTTCCACAGATCTGGTTGGG - Intronic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935327612 2:101951399-101951421 ATTTTTCCACTGATGGACTTTGG - Intergenic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
935611190 2:105027381-105027403 ATTTTTCCACCAATGGTGTTTGG + Intergenic
935784174 2:106533870-106533892 AGTTTGCCACAGGTGGACATTGG + Intergenic
936034540 2:109100437-109100459 ATTTTTCCACGGACTGAGATGGG - Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
936645451 2:114364486-114364508 ATTTTTTATCAGATGAAGATGGG - Intergenic
936958058 2:118043211-118043233 ATTTTTCAACAAATGGTGCTGGG - Intergenic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
938985373 2:136570414-136570436 GTTTTTCCACAGATGTGGATGGG + Intergenic
939370428 2:141292236-141292258 ATTTTTCCACAGACCGGGATGGG - Intronic
940259158 2:151762739-151762761 ATTTATCCTTAGATGGAAATAGG + Intergenic
940312371 2:152292124-152292146 ATTTTTCCATGGATGGTGGTGGG - Intergenic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
940723832 2:157311955-157311977 TTTTTTCCACTGATTCAGATTGG - Exonic
940789171 2:158013698-158013720 ATTTTTCCTGAGAAGGAGAAGGG + Intronic
940948394 2:159644863-159644885 AGTTTTCAGAAGATGGAGATTGG - Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
942040535 2:172057560-172057582 ATTTTTCCAAAAGTGGTGATGGG - Intronic
942104937 2:172624524-172624546 ATTTTTCCATGGATGGTGTTCGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942549810 2:177103629-177103651 ATTTTTCCACAGACCGGGCTGGG + Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
942993593 2:182233279-182233301 ATTTTTCTACAGACTGAGTTGGG + Intronic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943162298 2:184269847-184269869 ATTTTTCCATGGATGGGGGTGGG + Intergenic
943256732 2:185602996-185603018 ATTTTTACACGGATGGGGTTGGG - Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
943812801 2:192210563-192210585 ATTTGGCCTCAGATGGAAATGGG + Intergenic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944101814 2:196035888-196035910 ATTGTTCCAGAGATGGAACTTGG + Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
944433567 2:199662347-199662369 ATTTTTTCTCTGATGAAGATGGG - Intergenic
944477578 2:200123530-200123552 ATTTTTCCATTGACGGACATTGG - Intergenic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947482410 2:230512658-230512680 GTTTTTCCACAGACCGGGATGGG + Intronic
948401257 2:237687161-237687183 ACTTGTCCACAGATGCACATTGG - Intronic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
1169293554 20:4373218-4373240 ATTCTTACACAGGTGGACATGGG - Intergenic
1169504034 20:6189229-6189251 CATTTTCTACATATGGAGATAGG - Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1170797098 20:19557469-19557491 ATTTGTCAATAGATGGACATAGG - Intronic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1173121818 20:40299586-40299608 TTTTTTCCACACTTGGAGAGAGG + Intergenic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174660047 20:52204492-52204514 ACTTTTGCACATATAGAGATCGG + Intergenic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1175317900 20:58064549-58064571 CTTGTTCCACAGTTGGGGATCGG + Intergenic
1176295533 21:5070139-5070161 ATTTTTCCATGGATGCAGGTAGG + Intergenic
1176308532 21:5137055-5137077 ATTTTTCCACAGACAGGGTTGGG - Intronic
1178306161 21:31491809-31491831 ATTTTTTCAAGGATGGAGGTTGG + Intronic
1178319776 21:31596583-31596605 ATTTTTCCATACATGGGGGTGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1179848527 21:44124977-44124999 ATTTTTCCACAGACAGGGTTGGG + Intronic
1179861517 21:44191985-44192007 ATTTTTCCATGGATGCAGGTAGG - Intergenic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1182722542 22:32415032-32415054 ATTTTTCCACTGACTGGGATTGG + Intronic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1183593926 22:38798326-38798348 ATTGTTGCACTCATGGAGATGGG - Intergenic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185189455 22:49425206-49425228 ATTTTCCCACGGATGGAAGTGGG + Intronic
949106502 3:206077-206099 ACTTTTCCACAAATGGATAATGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949434410 3:4013048-4013070 ATTTTTCCCCATATGGAGGTGGG + Intronic
950492776 3:13316338-13316360 ATTTTTCTAAAGCTGGAGAAAGG - Exonic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952186164 3:30971394-30971416 ATTTTCTCACAGATTGAGGTAGG + Intergenic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
954594787 3:51815154-51815176 TTTTGTGCACAGAAGGAGATGGG + Intergenic
954725032 3:52601309-52601331 ATTTTTCCACAGACAGGGATGGG + Intronic
955157504 3:56431240-56431262 GTTTTTCCAAAAATGGAGCTAGG - Intronic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
957755423 3:84478665-84478687 AATTTTCCAAATATGGAGAAAGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957833519 3:85554094-85554116 ATTTTTCCACAGAAGTAGTCAGG + Intronic
959156779 3:102676198-102676220 ATTTTTCAACACTTGGAGAAGGG - Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960333317 3:116389259-116389281 ATTCTACCACAGCTGGAGGTAGG - Intronic
960672910 3:120169344-120169366 GTTTTTCCACAGATAGTGGTGGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961580809 3:127880478-127880500 ATTTTTCCACTGATGAGGGTGGG + Intergenic
961727263 3:128939718-128939740 ATTTTTCCACGGACGGGGTTGGG + Intronic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962087650 3:132208736-132208758 ATTCTTACAGAAATGGAGATAGG - Intronic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962856352 3:139349264-139349286 ATTTTTCCTCAGAAGGATTTTGG - Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
962950735 3:140216215-140216237 ATTTTTCCATGGATGGGGGTGGG - Intronic
963064822 3:141255438-141255460 TCTTTTCCACAGAAGGTGATGGG + Intronic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
963439146 3:145314988-145315010 ATATTTGCTCATATGGAGATAGG - Intergenic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
964583115 3:158261995-158262017 ATTTTTCCATGGATGGGGCTGGG - Intronic
964814516 3:160702413-160702435 TTTTTTCCAGAGAGGGAAATAGG - Intergenic
965147936 3:164930004-164930026 ATTTTTCTACAGATAGAACTTGG + Intergenic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
968776782 4:2546662-2546684 ATTTTTCCATTGGTGGACATTGG + Intronic
969204104 4:5629533-5629555 ATATTTCCACAGATAGAAAAAGG - Intronic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
969963817 4:10974040-10974062 AATGTTACACAGGTGGAGATTGG - Intergenic
970038807 4:11772501-11772523 ATTTTTCCACAGACTGGGATGGG + Intergenic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
970900485 4:21152902-21152924 ATTTTTCCACAGACAGGGTTGGG - Intronic
971673142 4:29590644-29590666 ATTTTTCCACAGACTAGGATTGG + Intergenic
971879476 4:32351559-32351581 AGTTTTCCACAGATGGGCAGAGG + Intergenic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973117467 4:46478878-46478900 ATTTTTCCACGGACGGGGATGGG - Intergenic
973212458 4:47631672-47631694 ATTTTTCCACAGACTGGGATGGG - Intronic
973654233 4:53029212-53029234 ATTTTTCCAAAGATGAAGATTGG - Intronic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
975383471 4:73728824-73728846 ATTTTTAAAAAGATGGAGAGGGG - Intergenic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
975725328 4:77285957-77285979 ATTTTTCCACAGAAGGGTCTGGG + Intronic
975748322 4:77496206-77496228 ATTTTTCCATGGATAGGGATGGG - Intergenic
975798754 4:78036440-78036462 ATTTTTCCATGGATGGAGGTGGG + Intergenic
975870484 4:78775017-78775039 ACTTTTCCACAAAAGAAGATAGG - Intergenic
976051798 4:81018640-81018662 CTCTTTCCACATATAGAGATAGG - Intergenic
976097353 4:81523351-81523373 TTTTTTTAACAGATGGAGATAGG + Intronic
976342349 4:83959249-83959271 ATTTTTCCACAGACAGGGAGTGG + Intergenic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
977119392 4:93078294-93078316 ATTTTTCCTCAACTAGAGATTGG - Intronic
977880518 4:102199087-102199109 ATATTTCCACATATGGATTTTGG + Intergenic
977977486 4:103284252-103284274 ATTTTCTCACAGTTTGAGATTGG - Intergenic
978091525 4:104722844-104722866 ATTTTTCTATTGATGGATATTGG - Intergenic
978543466 4:109843971-109843993 ATTTATCCAGAGATGTAAATTGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
979972559 4:127155010-127155032 ATTTTTCCATGGATGTAGAGAGG - Intergenic
980193136 4:129551306-129551328 ATTTTTCCGCGGATGGACCTGGG - Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
982983631 4:162175440-162175462 ATTCATCCATTGATGGAGATTGG - Intergenic
983035278 4:162857358-162857380 CTTTTTCCAAAAATAGAGATGGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984536059 4:180976983-180977005 ATTTATCTCCAGATTGAGATTGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984736082 4:183109453-183109475 ATTTTTCCACAGAATGGGATTGG + Intronic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985624036 5:975346-975368 ATTCTTCCATTGATGGAGAAGGG - Intergenic
985624054 5:975482-975504 ATTCTTCCATGGATGGAGAAGGG - Intergenic
985624061 5:975550-975572 ATTCTTCCATTGATGGAGAAGGG - Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624086 5:975754-975776 ATTCTTCCATTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986232319 5:5877643-5877665 ATTTTTCCACAGAAGAACCTGGG + Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988626143 5:32876760-32876782 ATTTTTCCGCGGATGGGGATGGG - Intergenic
988641739 5:33048324-33048346 ATTTTTCCATGGATGGTGAAGGG + Intergenic
988813599 5:34808792-34808814 ATTTTTCCATGGATGGGGGTGGG + Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989552381 5:42751017-42751039 AATTTTCCACAGACTGGGATGGG - Intergenic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
989684322 5:44067054-44067076 ATTTTTCCATAAATAGAGCTAGG - Intergenic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990937326 5:61164273-61164295 ATTTTTCCATGGACGGGGATGGG - Intergenic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991665600 5:68996654-68996676 ATTTTTCTATGGAAGGAGATCGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
993140373 5:84025574-84025596 ATTTTTCCACAGACTGGGTTGGG - Intronic
993341041 5:86725318-86725340 ATTTTTCCATTGATGGACACAGG + Intergenic
993599775 5:89907413-89907435 AATTTTCCAAAGGTGGAGAGAGG - Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
995340942 5:111058481-111058503 ATTTTTCCCCTGCTGGAGCTAGG - Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996228326 5:121029982-121030004 ATTTTTCCACAGACTGTGGTGGG + Intergenic
996808695 5:127488865-127488887 ATTTTTCCATGGATGGGGATGGG + Intergenic
996885704 5:128351208-128351230 TTTTTTCCTCTGGTGGAGATGGG - Intronic
996994257 5:129676118-129676140 ATTTTTCCACTGATTATGATAGG + Intronic
997098165 5:130937408-130937430 ATTTTTCCGCAGATGAAGGGGGG - Intergenic
997169457 5:131701226-131701248 ATTTTTTCACGGATGGGGCTGGG - Intronic
997317996 5:132954166-132954188 ATTTTTCCATGGATGGACAGGGG + Intronic
997885206 5:137623900-137623922 CTTCTTCTACAGATGGATATTGG - Intronic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998904014 5:146884329-146884351 AATTTTCCTCTGATGGATATGGG - Intronic
999048810 5:148499616-148499638 ATTATTCCATTTATGGAGATAGG + Intronic
999102392 5:149037214-149037236 ATATTTCAACAGATGTTGATGGG - Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999725711 5:154435651-154435673 ATTTTTCCACGGTTGGGGGTGGG - Intergenic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
999881905 5:155874127-155874149 ATTTTTCAAAAGAAGGGGATAGG + Intronic
999945670 5:156592606-156592628 ATTATTCCACAGAAGGAAAGGGG - Intronic
1000606294 5:163331119-163331141 ATTTTTGCACAGGTGGTGTTAGG + Intergenic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1001538138 5:172514131-172514153 ATTTTTCCACAGCCAGAGTTGGG - Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001814226 5:174654533-174654555 ATTTTGGCACATGTGGAGATGGG - Intergenic
1001853799 5:174993164-174993186 AGCTTTCCTCAGATGGAGGTTGG + Intergenic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004609772 6:17229132-17229154 ATTTTTCTACATTTGGTGATTGG + Intergenic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1005283288 6:24298053-24298075 ATTTCTCCACAGACGGAGTGGGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1005892001 6:30147750-30147772 ATTTATCCCCAGTTGGAGAAAGG + Exonic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008967487 6:57327851-57327873 ATTTTTCCACGGACTGAGGTCGG + Intronic
1009192081 6:60641457-60641479 ATTTTACCTCAGATAGAGAAAGG - Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1010393516 6:75363784-75363806 ATTTTTCCAGTAATGGTGATGGG + Intronic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011571870 6:88746495-88746517 ATTTTTCCACAAATGTTGGTGGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1012758787 6:103268450-103268472 AGTTTTCCCCAAATGGAGATAGG - Intergenic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014744995 6:125190486-125190508 GTTTTTCCACAGACGAAGGTTGG + Intronic
1014895878 6:126898425-126898447 ATTTTTCCATGGATGGGTATGGG + Intergenic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015812422 6:137174123-137174145 AGTTTTCCAGAGAGGGAGAAGGG - Intergenic
1015866529 6:137732704-137732726 GTTTTTCCACAACTGTAGATTGG + Intergenic
1016011341 6:139140201-139140223 ATTTTCCTACTGATGGATATAGG - Intronic
1016663007 6:146602884-146602906 ATTTTTCCATGGATGGAGAGGGG - Intronic
1016952984 6:149599222-149599244 CTTTTTCAACAAATGGAGAGAGG + Intronic
1017055820 6:150434733-150434755 ATATTTCCATGGATGGAGGTGGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017324050 6:153126996-153127018 ATTTTTCCACGGATGGCAGTGGG + Intronic
1017739008 6:157388708-157388730 ATTTTTTAAAAGATGGAAATTGG - Intronic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1018222073 6:161591155-161591177 ATATGTACACAGATGGAGACAGG + Intronic
1019196704 6:170287384-170287406 ATTTCTCTACAGCTGGGGATTGG - Intronic
1019721779 7:2576752-2576774 ATTTGTCCACAGATAAAGATTGG + Intronic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021710218 7:23408950-23408972 ATTTTTCCACGGACAGAGAGTGG + Intronic
1022738158 7:33095381-33095403 ATTCTACCTCAGATGAAGATAGG - Exonic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1024042497 7:45566175-45566197 ATTCTCCCACAGATGGGCATTGG + Intergenic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1026149563 7:67776416-67776438 ATTTTTCCAAGGATGGGGTTGGG + Intergenic
1026499257 7:70929058-70929080 ATTTTAACACATATGTAGATTGG + Intergenic
1027028667 7:74872929-74872951 ATTTTTCAACGAATGGGGATGGG - Intergenic
1027173892 7:75891109-75891131 ATTTTTCCACAGACAGGTATGGG + Intergenic
1027544873 7:79515043-79515065 ATTTTTCAACATATGAATATTGG - Intergenic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1027878380 7:83800965-83800987 ATTTGTCCTTAGATAGAGATTGG + Intergenic
1027905420 7:84174217-84174239 ATTTGTCCACAGACTGGGATTGG - Intronic
1027980452 7:85213612-85213634 ATTTCTTCACAGATGGATAAAGG + Intergenic
1028057198 7:86261173-86261195 ATTTTTCCACGGACGGGGAAGGG + Intergenic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1030625046 7:111835764-111835786 ATTTTTCAACAGAAGCAGCTGGG + Intronic
1030810863 7:113970764-113970786 ATTTTTCCATATATGGACAAGGG + Intronic
1030948805 7:115763330-115763352 ATTTTTCCACGGAAGGGGAGTGG + Intergenic
1031089602 7:117338609-117338631 GTTGTTCCACAGATGAAGATTGG - Intergenic
1031221820 7:118976319-118976341 ATTTTTCCACGGACGGGGAGGGG + Intergenic
1031223949 7:119010566-119010588 ATTTTTCCACAAATGAAGGTGGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031322239 7:120345738-120345760 ATTTATCCATAGATGGACACAGG + Intronic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033135425 7:138780212-138780234 GTTTTTCCACGAATGGAGGTTGG + Intronic
1033501328 7:141952971-141952993 TTTGTTTCACAGATGGACATTGG - Intronic
1033572396 7:142643771-142643793 ATTTTTCAATAAATGGTGATAGG + Intergenic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1036132707 8:6131276-6131298 ATTTTTCCACGGATGAGGACGGG + Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1037293192 8:17373025-17373047 ATTTTTCCTCAGGGTGAGATGGG - Intronic
1037376705 8:18238167-18238189 ATTTTTCCATGGATGGGGTTAGG + Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038514898 8:28179494-28179516 ATTTTTCCACAGATAGTAAGGGG + Intronic
1038523317 8:28252297-28252319 ATTTTTCCCTAGATAGAGAGAGG + Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1040902658 8:52432682-52432704 TTTTTTCCACACATAGAAATAGG - Intronic
1040918822 8:52593363-52593385 ATCTTTGCACAGTTGGTGATAGG - Intergenic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041555080 8:59144785-59144807 ATTCATCCACGGATGGACATTGG + Intergenic
1041819099 8:62009418-62009440 ATTTTTCCAGGGATTGAGGTGGG + Intergenic
1042378250 8:68081127-68081149 ATTTTTCCACAGGCGGAGGGTGG + Intronic
1042910842 8:73824599-73824621 ATTTTTCCATGGATGGGGTTGGG + Intronic
1043262051 8:78213690-78213712 ATTATTCCACAGATAAATATGGG - Intergenic
1043866829 8:85384163-85384185 ATTTTTCCACAGACCGACGTGGG - Intronic
1043870529 8:85426684-85426706 ATTTCTCCACATTAGGAGATGGG - Intronic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044202050 8:89449880-89449902 ATTTTGCCACTACTGGAGATGGG - Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044824439 8:96182860-96182882 ATTTCTTCATAGATGGACATTGG + Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045531509 8:102989437-102989459 ATTCTTCCACACATGGTGGTAGG - Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046673992 8:117088757-117088779 ATGATTTCACAGATGGTGATGGG + Intronic
1047532433 8:125689163-125689185 ATTTTTCAACACATGGACTTTGG + Intergenic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048949602 8:139484730-139484752 ATTTTTCCAAAAATGTAGTTAGG + Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1051689606 9:19696237-19696259 GTTTTTCCACAGACCGAGGTTGG - Intronic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052884915 9:33635827-33635849 ATTTTTCAACAAATGGTGATGGG + Intergenic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1055501879 9:76909433-76909455 AATGTTCCAGAGATGGAGCTTGG - Intergenic
1055517086 9:77044196-77044218 ATTTTTTCAGAGATGGAACTGGG + Intergenic
1055602148 9:77931064-77931086 ATTTTTCCAGGGATGGGGGTCGG - Intronic
1055767882 9:79684599-79684621 ATTTTTCCATGGACGGAGGTGGG - Intronic
1055793376 9:79947553-79947575 ATCTCTACACAGATGGAGTTTGG - Intergenic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1056593754 9:87987752-87987774 AGTTTTCCACGGATGGAAGTAGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG + Intergenic
1058075778 9:100649279-100649301 ATTTTTGTACAAATGGAGAGGGG + Intergenic
1058263046 9:102860454-102860476 AATTTTCTCCAGGTGGAGATAGG + Intergenic
1059502823 9:114769934-114769956 ACTTTTGCACAAATGGAGAAGGG + Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060317122 9:122522457-122522479 ATTTTGTCACAGATGGAAAGTGG + Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1060870663 9:127037388-127037410 CTTTTTCCATTCATGGAGATTGG + Intronic
1060874382 9:127070067-127070089 GTTTTTCCACGGATGGAGAGTGG + Intronic
1061400218 9:130364499-130364521 ATGTTTCCACCGAGGGAAATTGG - Intronic
1061527860 9:131182548-131182570 TTTTTTCCACAGACGGACAGCGG - Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1185985338 X:4826530-4826552 ATTTTTCCATGGATGAAGGTTGG + Intergenic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186682030 X:11885126-11885148 ATTTATCCACTGATGGACACTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1190840693 X:54141407-54141429 ATTTTTCCACATATATTGATAGG - Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1192991906 X:76468424-76468446 ATTCTTCTACATATGGATATTGG - Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193365180 X:80623256-80623278 ATTTTTCCCCTGCTGGAGCTGGG - Intergenic
1193572677 X:83162592-83162614 ATTTTTACACAAAAGAAGATTGG - Intergenic
1194292749 X:92095115-92095137 ATTTCACCACAGCTGGGGATTGG - Intronic
1194322868 X:92474082-92474104 ATTGAGCCACAGATAGAGATAGG - Intronic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195143182 X:101985094-101985116 ATTTCTCCAAAAATGGTGATTGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1196746589 X:119076551-119076573 ATTTTTGCAAAGAGAGAGATGGG + Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197456888 X:126687873-126687895 ATTTTTACATAGAGAGAGATGGG - Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1197840874 X:130745037-130745059 ATTTTTCCACAGACTGAGTCGGG - Intronic
1198270898 X:135055377-135055399 ATTTTTCCATGGATGGGGCTGGG + Intergenic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1198445285 X:136707487-136707509 ATTTTTCTACAAATGAAGACAGG - Intronic
1199941295 X:152630405-152630427 ACTTTTACACAGAGTGAGATAGG - Intergenic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic
1200417879 Y:2931699-2931721 ATTTTTCCACAGGTGTACAGTGG + Intronic
1200610255 Y:5319677-5319699 ATTTCACCACAGCTGGGGATTGG - Intronic
1200631021 Y:5587561-5587583 ATTGAGCCACAGATAGAGATAGG - Intronic
1201241862 Y:11965119-11965141 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1201939628 Y:19445982-19446004 ATGTTTCTACACAGGGAGATGGG - Intergenic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic
1202070326 Y:20985468-20985490 ACTTTTCCCCTGATGGAGACAGG - Intergenic
1202193157 Y:22265806-22265828 ATTTTTCCACAGATCATGAGTGG + Intergenic