ID: 951554345

View in Genome Browser
Species Human (GRCh38)
Location 3:23905714-23905736
Sequence ATGTTGAAGGCCATCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951554343_951554345 -10 Left 951554343 3:23905701-23905723 CCAGGTAGAGGGCATGTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG 0: 1
1: 0
2: 0
3: 9
4: 126
951554342_951554345 -9 Left 951554342 3:23905700-23905722 CCCAGGTAGAGGGCATGTTGAAG 0: 1
1: 0
2: 1
3: 13
4: 158
Right 951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG 0: 1
1: 0
2: 0
3: 9
4: 126
951554336_951554345 11 Left 951554336 3:23905680-23905702 CCCCAGGGTCACGACTACGTCCC 0: 1
1: 0
2: 0
3: 1
4: 53
Right 951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG 0: 1
1: 0
2: 0
3: 9
4: 126
951554338_951554345 9 Left 951554338 3:23905682-23905704 CCAGGGTCACGACTACGTCCCAG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG 0: 1
1: 0
2: 0
3: 9
4: 126
951554337_951554345 10 Left 951554337 3:23905681-23905703 CCCAGGGTCACGACTACGTCCCA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951554345 Original CRISPR ATGTTGAAGGCCATCATCAC TGG Intronic
908737051 1:67287958-67287980 ATCCTGAAGGGCATCATCTCAGG - Intergenic
913552938 1:119934738-119934760 ATGTAAAAGGCCATCCACACTGG - Intronic
913608525 1:120488931-120488953 ATATTGAAGGCCAACATAACTGG - Intergenic
913986905 1:143573739-143573761 ATATTGAAGGCCAACATAACTGG + Intergenic
914370269 1:147018711-147018733 ATATTGAAGGCCAACATAACTGG - Intergenic
914438124 1:147678775-147678797 ATGATGAATGCCATTATTACAGG - Intergenic
914484425 1:148094702-148094724 ATATTGAAGGCCAACATAACTGG + Intergenic
914582677 1:149032907-149032929 ATATTGAAGGCCAACATAACTGG + Exonic
916381517 1:164217007-164217029 ATGTTGATGTACATCATCATGGG - Intergenic
916497940 1:165361965-165361987 TTGTCCAAGGCCATCATCAGTGG - Intergenic
916863462 1:168831640-168831662 ATGAGGGAGACCATCATCACAGG - Intergenic
923394562 1:233548516-233548538 AAGTTGTTGGCCATCATCACTGG + Intergenic
924686002 1:246290567-246290589 ATTTTCAAGGCCATAAACACTGG + Intronic
1062872412 10:917028-917050 ATTTTGAAGACCATTATCATTGG + Intronic
1065692366 10:28347687-28347709 AGGTTGAAAGCAACCATCACAGG - Intergenic
1065880609 10:30034570-30034592 ATTTTGAAAGCCATCGTCACTGG + Intronic
1069060027 10:63885575-63885597 ATGAAGAAGGCCATTAACACTGG + Intergenic
1071290398 10:84184872-84184894 ATGTTGGAGGGCTTCATCTCGGG + Exonic
1072866677 10:99069292-99069314 ATATTTAAGGCCATTATCATGGG + Intronic
1079015175 11:16862676-16862698 GTTTTGAAGGGCATCAGCACTGG - Intronic
1080819961 11:35796164-35796186 CAGTTGAAGGTCATCATCATGGG + Intronic
1082328483 11:51179245-51179267 AAGTTGAATGCAGTCATCACAGG - Intergenic
1082332036 11:51231093-51231115 GAGTTGAACGCAATCATCACAGG - Intergenic
1082335184 11:51276658-51276680 GAGTTGAATGCAATCATCACAGG - Intergenic
1082355710 11:51574876-51574898 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082371293 11:51801859-51801881 AAGTTGAATGCAGTCATCACAGG - Intergenic
1082423559 11:52559560-52559582 GAGTTGAATGCCGTCATCACAGG - Intergenic
1082430425 11:52658991-52659013 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082433019 11:52696395-52696417 GAGTTGAATGCCGTCATCACAGG - Intergenic
1082440081 11:52798403-52798425 GAGTTGAATGCCGTCATCACAGG - Intergenic
1082440485 11:52804336-52804358 AAGTTGAATGCAGTCATCACAGG - Intergenic
1082441257 11:52815387-52815409 GAGTTGAATGCAATCATCACAGG - Intergenic
1082441553 11:52819637-52819659 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082476605 11:53327353-53327375 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082487885 11:53489717-53489739 GAGTTGAATGCAATCATCACAGG - Intergenic
1082490766 11:53531214-53531236 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082515226 11:53884315-53884337 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082525050 11:54026647-54026669 TTGTTGAATGCAGTCATCACAGG - Intergenic
1082534074 11:54157403-54157425 GTGTTGAATGCAGTCATCACAGG - Intergenic
1082536523 11:54193113-54193135 GAGTTGAATGCAATCATCACAGG - Intergenic
1082545182 11:54318268-54318290 AAGTTGAATGCAGTCATCACAGG - Intergenic
1085879313 11:80446776-80446798 ATGGTGGAACCCATCATCACAGG - Intergenic
1087054502 11:93920455-93920477 ATGTTCCAGGCCATCATTTCTGG + Intergenic
1089066051 11:115662778-115662800 AGGTTGATGCCCAACATCACAGG - Intergenic
1092063991 12:5574320-5574342 TGATTGAAGGCCATCAGCACTGG - Intronic
1093567173 12:20621315-20621337 TTGGTGAGGGTCATCATCACTGG - Exonic
1095616735 12:44199116-44199138 ATGATGAAGGACATGAGCACTGG - Intronic
1096685405 12:53285310-53285332 ATGTTTGGGGCCAGCATCACAGG + Intronic
1097047002 12:56194661-56194683 ACCTTGAAGGCCATCGTAACAGG - Intergenic
1098664236 12:73140270-73140292 GTGTTAAAGCTCATCATCACTGG - Intergenic
1098858948 12:75686097-75686119 ATGATAAAGGCTGTCATCACTGG + Intergenic
1101451977 12:104788145-104788167 ATGTTGATTGATATCATCACAGG - Intergenic
1101989060 12:109469544-109469566 ATGCTGAAGGCCATGTTCAGCGG - Exonic
1103482732 12:121261402-121261424 CAGTTGCAGGCCATCACCACCGG - Intronic
1106100076 13:26686937-26686959 AGGGTGAAGGCCCTCCTCACGGG - Exonic
1107066664 13:36220699-36220721 ATGGTGAAAGCCCTCTTCACTGG - Intronic
1107125259 13:36839503-36839525 ATGTGGGTGGCCATCAACACTGG + Intergenic
1117005588 14:51418311-51418333 ATGTTGGTGACCATCATCATGGG + Intergenic
1125492994 15:40162254-40162276 ATGTCCAAGGCCATTGTCACTGG + Intronic
1127200649 15:56646118-56646140 AAGTTGAAGGTCATGATTACTGG - Intronic
1127634035 15:60852161-60852183 ATGTTTAAGGACACCATCATGGG + Intronic
1132190204 15:99848505-99848527 ATGTTGAAGAGCTTCATCATAGG - Intergenic
1145506617 17:24056389-24056411 GAGTTGAATGCAATCATCACAGG - Intergenic
1145516018 17:24192774-24192796 GAGTTGAATGCAATCATCACAGG - Intergenic
1148763986 17:50026956-50026978 ATGGTCAGGGCCAGCATCACCGG - Intergenic
1149929692 17:60738881-60738903 ATGTAGCAAGCCATCATGACTGG + Intronic
1153337115 18:3936271-3936293 GTGATGAAGGCCTTGATCACTGG - Intronic
1159478683 18:68959410-68959432 ATCTTTGAGGCCACCATCACTGG + Intronic
1164416054 19:28047256-28047278 ATGTTCATAGCCATCCTCACTGG - Intergenic
1164417898 19:28061453-28061475 ATGTTCATAGCCATCCTCACTGG - Intergenic
1165217744 19:34288624-34288646 ATGTCAAAGGCCACCATCAAAGG - Intronic
1166670399 19:44706467-44706489 ATGTTCAAAGCCACCATCTCCGG - Intronic
925381026 2:3426438-3426460 ATGTGGAAGGCCAGCAGGACTGG - Intronic
926673541 2:15599132-15599154 ATGTTGAAGATAATCATCACTGG - Intronic
928084845 2:28339648-28339670 GTGTGGAAGGCCATCAGGACAGG - Intergenic
928649122 2:33386421-33386443 ATGTCGAATGCCATGATCAGGGG - Intronic
931721954 2:65072913-65072935 ATGTTGAAGGGCAGCTTCCCAGG + Exonic
935670763 2:105555266-105555288 ATCTTCAATGCCAACATCACTGG - Intergenic
936481232 2:112886688-112886710 ATGTTGACTGCCTTCAGCACAGG + Intergenic
941686066 2:168450389-168450411 CTGTTGAGGGCCATCTTCAGTGG + Intergenic
948874048 2:240818108-240818130 ATCTTGCAGGCCCTCACCACAGG + Intronic
1169312017 20:4550982-4551004 ATGTTGTGGGGCATTATCACAGG - Intergenic
1170472705 20:16684198-16684220 ATGATGAGATCCATCATCACGGG - Intergenic
1171039117 20:21743205-21743227 ATGTTGAAGGGTATTGTCACCGG + Intergenic
1172812839 20:37662051-37662073 ATCTTCAAGGCCAGCAACACTGG + Intergenic
1173692202 20:44969619-44969641 ATGTGGATGGCCAGCATCCCAGG - Intronic
1177678105 21:24328697-24328719 ATGAAGAAGCTCATCATCACTGG - Intergenic
1178828617 21:36035926-36035948 ATTTTGAAGAGCATCATCATGGG - Exonic
1180719744 22:17898761-17898783 ATATTTCAGGCCATCATCTCAGG + Intronic
1184687052 22:46100981-46101003 AGGTTGAAGGGCATCAGCAGCGG + Intronic
1184711678 22:46254154-46254176 CTTTTGAAGGCCATTTTCACAGG - Intergenic
951554345 3:23905714-23905736 ATGTTGAAGGCCATCATCACTGG + Intronic
955749718 3:62175698-62175720 ACATTGAAGCCCATCATCAGTGG - Intronic
962033539 3:131626849-131626871 AAGTTGAAGTCCATGCTCACTGG + Intronic
967421128 3:189274022-189274044 ATGTTGAATGGCCTCATGACAGG + Intronic
970845418 4:20532167-20532189 ATGTTACAGGTCATCATCATAGG - Intronic
971081003 4:23211099-23211121 ATATTGAAGCCCATGATCAATGG + Intergenic
977350128 4:95873842-95873864 ATGTTGAAGGACATCACAAATGG - Intergenic
980589377 4:134864552-134864574 ATGTAGAATAACATCATCACAGG + Intergenic
986025378 5:3845719-3845741 ATGTTGAAAGCCAGCAGCAGTGG - Intergenic
987713546 5:21535468-21535490 CTGAGGAAGGTCATCATCACTGG + Intergenic
989270884 5:39531628-39531650 ATGGTGAAGGCCAGAGTCACTGG + Intergenic
992543206 5:77784932-77784954 ATGTGCAAGGCCAGCTTCACGGG + Intronic
993000682 5:82377831-82377853 ATTTTTAAGGCCATGATCATAGG + Intronic
1009003173 6:57746429-57746451 CTGAGGAAGGTCATCATCACTGG - Intergenic
1012163719 6:95922398-95922420 ATGTCAAAGCCCAACATCACTGG + Intergenic
1013007257 6:106085501-106085523 ACATTGTATGCCATCATCACAGG + Intergenic
1015969461 6:138729928-138729950 ATGTCGAAGACCAACATCAATGG + Intergenic
1016866320 6:148771047-148771069 TTGTAGAAGGCTATCATAACAGG - Intronic
1016980796 6:149852206-149852228 ATCTGGAAGTCCCTCATCACTGG - Intronic
1018940358 6:168305423-168305445 GTGTTGCAGGCCAAGATCACAGG - Intronic
1025739444 7:64183598-64183620 ATGAGGAAGGCCATCACCCCGGG - Intronic
1026039488 7:66855731-66855753 ATGTAGAAGGCCTTCCCCACAGG + Intergenic
1026452739 7:70543655-70543677 ATTTTGAAGGCAAGCATGACGGG - Intronic
1030078945 7:105760868-105760890 ATTTTGAAGGCCAGCTTGACTGG + Intronic
1034140299 7:148809246-148809268 GTATTCAAGTCCATCATCACAGG + Intronic
1034868900 7:154665252-154665274 ATGACCAAGGCCAACATCACTGG - Intronic
1034898541 7:154892978-154893000 ATGTTGAACGTCCTCATTACAGG - Exonic
1035561073 8:603886-603908 GTGTTGCAGGACATCAGCACTGG - Intergenic
1041304319 8:56445171-56445193 AAGTTGAATTCCAGCATCACTGG + Intronic
1041859878 8:62500915-62500937 ATGATGCACGCCATCATAACGGG + Intronic
1042379023 8:68091545-68091567 ATTTTGCAGGCCATCAGCCCTGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043113300 8:76215811-76215833 ATTTTCAAGGCCATCTTCCCTGG + Intergenic
1043683308 8:83058694-83058716 ATTTTGAAGGCCTGTATCACTGG - Intergenic
1050821692 9:9887515-9887537 ATGGTAAAGCCCATCATCAAGGG + Intronic
1051032329 9:12696267-12696289 ATGTTGGAGGGAATCATCGCTGG - Intronic
1055623146 9:78146748-78146770 ATGTTGGAGGTCATCATGAATGG - Intergenic
1056017414 9:82404928-82404950 ATGTTGCAGGCTATCTTCAAAGG + Intergenic
1058001327 9:99869079-99869101 ATGGGGATGGCCAGCATCACAGG - Intergenic
1061650274 9:132042215-132042237 ATGGTGACGGCCATCACTACCGG + Intronic
1061943277 9:133894271-133894293 ATGGTGCCGGCCATCAGCACCGG + Intronic
1189703799 X:43739320-43739342 ATGTTGCATGACATCATCTCAGG + Intronic
1190523275 X:51301361-51301383 ATGTTGAAGGATATTTTCACTGG - Intergenic
1193456826 X:81741903-81741925 TAGCTGGAGGCCATCATCACAGG - Intergenic
1199095747 X:143736306-143736328 AGGTTGAAGGCCGTCATCCCTGG - Intergenic