ID: 951554432

View in Genome Browser
Species Human (GRCh38)
Location 3:23906537-23906559
Sequence TAGACTGAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1349
Summary {0: 1, 1: 3, 2: 25, 3: 150, 4: 1170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951554432_951554437 -2 Left 951554432 3:23906537-23906559 CCCTCCTCCTTCTCCTCAGTCTA 0: 1
1: 3
2: 25
3: 150
4: 1170
Right 951554437 3:23906558-23906580 TACTCCACATAAAAACAATGAGG 0: 1
1: 0
2: 12
3: 50
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951554432 Original CRISPR TAGACTGAGGAGAAGGAGGA GGG (reversed) Intronic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900204459 1:1426146-1426168 GAGACGGAGGAGGAGGAGGGGGG + Exonic
900807538 1:4777327-4777349 TAGACTGAGAAGAAAGACAATGG - Intronic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
902408267 1:16198393-16198415 GACACTGAGGAGCATGAGGACGG + Exonic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903410498 1:23139483-23139505 TAGGCTGAGGAGGGAGAGGAAGG - Intronic
903986795 1:27234667-27234689 TAAACAGAGGAGGAGGAGGGAGG + Exonic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
904932429 1:34099938-34099960 TTGGCTGATGAGAAGGTGGAAGG + Intronic
904939826 1:34157782-34157804 TAGACTGAGCTCAAGTAGGAAGG - Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
905791975 1:40794599-40794621 AAAACTGAGGAGAATAAGGACGG + Intronic
905845186 1:41224099-41224121 TAGACTGAGGAGGTGAAAGAGGG - Intronic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906281766 1:44559503-44559525 TATAGAGATGAGAAGGAGGAAGG + Intronic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
906969762 1:50499199-50499221 GAGTCTGAGGGGAAGGAGAATGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907038192 1:51235402-51235424 TAGCCTGATGAGAAGCAGAAAGG + Intergenic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
907228157 1:52969059-52969081 TAGGCTGAGGAGGAAGGGGAAGG + Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909419230 1:75444933-75444955 GAGATTGAGGAGAAAGAAGAAGG + Intronic
909495072 1:76269217-76269239 AAGACTGACAACAAGGAGGAAGG - Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910165769 1:84325878-84325900 GAAACTGAGGGGAAGGAGAATGG + Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910315610 1:85879765-85879787 TAGGCTGAGGAGGTGGAAGAAGG + Intronic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911076615 1:93881716-93881738 TAAGCTGAGGAGGAAGAGGAGGG - Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911463743 1:98224245-98224267 TAGAGTGAGGAGAAGCGGGAAGG + Intergenic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912587046 1:110776589-110776611 TTGACTGAGAAGAAGCATGAGGG + Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
912953312 1:114135472-114135494 TAGGAGGAGGAGATGGAGGAGGG + Intronic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913452779 1:119003389-119003411 GAGACAGAGGAGAAAGAGAAAGG + Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
915887479 1:159738593-159738615 TAGACTGAGGAAGGGGAGGAAGG - Intergenic
916024734 1:160823819-160823841 TAGACATGGGAGGAGGAGGAAGG - Intronic
916025046 1:160826250-160826272 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
916636846 1:166680051-166680073 GAGACTGAGAAGGAGGAGGGAGG - Intergenic
916818089 1:168372604-168372626 CTGACTGAGGAAATGGAGGAGGG + Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917156142 1:172001043-172001065 TTGATTTAGGAGAATGAGGATGG + Intronic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
918135928 1:181673916-181673938 TACACTGAGGAGCAGGGTGAAGG - Intronic
918606915 1:186438493-186438515 GAGACTGAGGAGAATAATGAAGG + Intergenic
918666663 1:187159624-187159646 TATACTGAAGAGCAGGAGGTAGG - Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919538339 1:198816245-198816267 TAGGCTAAGGAGAAGTAGAAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920122449 1:203668881-203668903 TAGATTGGGGAGAAGGAGGTAGG + Intronic
920383940 1:205554009-205554031 AAGACAGATGAGAAGGTGGAGGG + Intergenic
920894163 1:210027514-210027536 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921513639 1:216063383-216063405 AAGACTCAGGATAATGAGGAGGG - Intronic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
921958304 1:221007074-221007096 TAGACTGAGGTTAAGGATGTTGG + Intergenic
922002349 1:221492323-221492345 TAGTCTGAGGAACAGGAGAAAGG + Intergenic
922213488 1:223502640-223502662 TAGGCGGACGAAAAGGAGGAAGG + Intergenic
922592404 1:226787191-226787213 TAGATGGAGGACAATGAGGATGG + Intergenic
922613324 1:226945758-226945780 AAGACTGAGGGAAAAGAGGAGGG - Intronic
922662972 1:227446486-227446508 TAGAAGGAGTAGAAGCAGGAGGG + Intergenic
922723853 1:227913607-227913629 AAGGCTGAGGAGGAGGAGGGAGG + Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923237846 1:232051650-232051672 GAGACAGAGGAGGAGGAGGTAGG + Intergenic
923296777 1:232602116-232602138 AAGACTGAAGACAAGGAGGTGGG + Intergenic
923314059 1:232762302-232762324 TAGGCTGAGGAAGAGGAAGAAGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924226313 1:241924580-241924602 TAGGCTGAGGAGGAAGAGGAAGG - Intergenic
924315520 1:242791446-242791468 TAGACTGAAGAGAAAGAGATGGG + Intergenic
924413181 1:243828536-243828558 TAGGCTGAGGAGGAAGAGAAAGG - Intronic
924551463 1:245081799-245081821 TACAGTGAGGGGAAGGAGCATGG - Intronic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1063034004 10:2267371-2267393 TATAAAGAGGAGAAGGAGGAAGG + Intergenic
1063040304 10:2331349-2331371 TAAAGCGAGGAGAAGGGGGAGGG + Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063245306 10:4211736-4211758 TGGGCCGAGGAGGAGGAGGAAGG + Intergenic
1063457934 10:6197722-6197744 TAGACTGGGAAGGAGGAAGAGGG + Intronic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1064248203 10:13686245-13686267 TACAGGGAGGAGAAGGAGGAAGG + Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064756497 10:18576318-18576340 TAGTCTGAGGAGAGCCAGGAGGG - Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1065478759 10:26171139-26171161 TACACTGGGGGCAAGGAGGAGGG + Intronic
1065578539 10:27148530-27148552 TGGGCTGAGGAGGAAGAGGAGGG - Intronic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065739080 10:28780597-28780619 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066075843 10:31875841-31875863 GGGACTGGGGAGAGGGAGGATGG - Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066495223 10:35935986-35936008 TAGATAGAGAAGAAGGAGAAAGG - Intergenic
1067310715 10:45111187-45111209 TGGGCTGAGGAGGAAGAGGAGGG - Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068387283 10:56347922-56347944 GACACTGAGGAGCATGAGGAAGG - Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068744415 10:60513985-60514007 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
1068903305 10:62294550-62294572 GAGATGGAGGAGGAGGAGGAAGG - Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069774179 10:70917291-70917313 GAGACTGAGGAGGAAGAGGAGGG - Intergenic
1069919638 10:71808655-71808677 TAGATGGAGAAGAAGGGGGAAGG - Intronic
1070107430 10:73448122-73448144 TAGACTGGGGATAAGCAGTAGGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1070640361 10:78164453-78164475 TTGACTCAGGACAGGGAGGATGG + Intergenic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071329916 10:84549032-84549054 GAGACTGGGGAGCTGGAGGATGG - Intergenic
1071382177 10:85077372-85077394 TGGGTTGAGGAGAAGGGGGAGGG + Intergenic
1071489381 10:86125731-86125753 TAGGCTGAGGAAGAGGCGGAAGG - Intronic
1071568037 10:86681559-86681581 GCGAGTGAGGAGAAGGCGGAGGG - Exonic
1071755155 10:88529143-88529165 AGGACTGAGGAGTGGGAGGAGGG - Intronic
1071824164 10:89307889-89307911 TAGACTGGGAAGGAGGAGGAAGG - Exonic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072391670 10:94993700-94993722 TAGTCTGAGGAGAGCTAGGAAGG + Intergenic
1072642053 10:97219093-97219115 TAGGTTGAGGAGGAAGAGGAGGG - Intronic
1072743545 10:97924463-97924485 TAGACTGAGGAGAGACAGCATGG + Intronic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1073991702 10:109268811-109268833 TAGCCTGAGGAGTGGGAGGATGG + Intergenic
1074020975 10:109582419-109582441 TAGGCTGAAGAGAAAAAGGAGGG + Intergenic
1074107193 10:110397343-110397365 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074781900 10:116808228-116808250 TAGACAGTGGAGAAGGAGCTTGG + Intergenic
1074947625 10:118296565-118296587 TCCTCTGAGGAGAAGGAGGCAGG - Intergenic
1075045742 10:119145193-119145215 TAGGCTGCGGAGGAGGAAGAGGG - Intronic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075445212 10:122508294-122508316 TAGACATGGGAGAAGCAGGAAGG + Intronic
1075762701 10:124869059-124869081 CAGACGGAGGAAAAGAAGGAAGG - Intergenic
1076223891 10:128757970-128757992 TGGACTGAGGACAGGGAGGCAGG + Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076562452 10:131376048-131376070 CAGCCTGAGGAGAAGAAGGTGGG - Intergenic
1076980931 11:204328-204350 GAGGCTGGGGACAAGGAGGATGG + Exonic
1076992256 11:281547-281569 GAGCCAGAGGAGGAGGAGGAGGG + Exonic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077392436 11:2306410-2306432 TAGAATGAGGAGAAAGAAAATGG + Intronic
1077392580 11:2306935-2306957 GGGAAGGAGGAGAAGGAGGAGGG + Intronic
1077521735 11:3040061-3040083 TAGACTGAGGAGGAGAAGGGGGG - Intronic
1078085737 11:8232163-8232185 TGCAGGGAGGAGAAGGAGGAGGG - Intronic
1078135039 11:8644778-8644800 TAGAATGAGGAGACTGAGGATGG - Intronic
1078156640 11:8805627-8805649 TAGGCTGGGAAAAAGGAGGAGGG - Intronic
1078453091 11:11454794-11454816 GAGACTGAGGAGACTCAGGAGGG - Intronic
1078550079 11:12274137-12274159 GACACTGTGGAGAGGGAGGAGGG + Intergenic
1078657962 11:13260033-13260055 AAAACAGAGGAGAAGGAGGGAGG + Intergenic
1078660416 11:13281215-13281237 TTGACTTAGGAGAGGAAGGATGG + Intronic
1078676060 11:13415496-13415518 TTTACTGGGGAGAAGGAGCAGGG - Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079115279 11:17636660-17636682 AAGACAGAAGAGAAGGAGAAAGG - Intronic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079518782 11:21300321-21300343 ATTACAGAGGAGAAGGAGGAAGG + Intronic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080187619 11:29509099-29509121 AATACTGAAGAGAAAGAGGATGG + Intergenic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1080890286 11:36403147-36403169 GACACTGAGGAAATGGAGGATGG + Intronic
1081156094 11:39692921-39692943 TAGGCTGAGGAGGAAGAGAAGGG - Intergenic
1081238714 11:40678288-40678310 TAGATGGGGGAGAAGGAGGAGGG - Intronic
1081369985 11:42288470-42288492 GAGACTGGGGAGAGGAAGGAGGG + Intergenic
1081761499 11:45579599-45579621 GAGAAGGAGGAGAAGAAGGAAGG - Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083082214 11:60105544-60105566 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083631546 11:64097923-64097945 TCCAGTGAGGAGAAGGAGGCGGG + Intronic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084072432 11:66745012-66745034 TCGCCTAAGGTGAAGGAGGAAGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084395736 11:68908795-68908817 AGGACTGAGTACAAGGAGGACGG - Intronic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1085027719 11:73246708-73246730 TAGGCTGAGGAAAAGGTGGAAGG - Intergenic
1085064758 11:73484081-73484103 TTGACTGAAGATAAGGAGGGAGG - Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086578586 11:88369839-88369861 TAGACTCAGGAGAAAGAGGTTGG - Intergenic
1086597397 11:88589734-88589756 TAGACATAGGAGCATGAGGAGGG - Intronic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086998895 11:93392910-93392932 AGGAGGGAGGAGAAGGAGGAGGG - Intronic
1087069621 11:94064831-94064853 TAGACTGACTGGAAGGAGAAAGG + Intronic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087241803 11:95789472-95789494 GAGACTGAGGAGCAGGATGGCGG - Exonic
1087446759 11:98265413-98265435 TAGACTAAGGAAAAAGAGAAAGG + Intergenic
1087711892 11:101563645-101563667 TGGAGTGAGGATAAAGAGGATGG + Intronic
1087798973 11:102483603-102483625 TAGTCTGTGGTGAAGGAAGAGGG - Intronic
1088015264 11:105050722-105050744 TAAGCTGAAGAGATGGAGGAAGG + Intronic
1088664078 11:112076682-112076704 TAGGCTGAGGAGGAAGAAGAGGG + Intronic
1088779946 11:113124209-113124231 TAGACTGAGAAGGAGGAAGGAGG + Intronic
1089028601 11:115298364-115298386 TAGAATGAGGAGAAGAAGAAAGG + Intronic
1089098220 11:115937642-115937664 GAGACTGAGGAAAATGAGGATGG + Intergenic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090092979 11:123715743-123715765 TAAGCTGAGGAGAAGGAACAAGG - Intergenic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090366504 11:126211306-126211328 GAGAATGGGGAGAAGGCGGAGGG - Intronic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1091036373 11:132237614-132237636 TACACTGTGGAGACGGAGGTGGG + Intronic
1091130609 11:133143941-133143963 TACTCTGTGGAGATGGAGGAGGG + Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091596542 12:1882566-1882588 AGGACTGTGGAGGAGGAGGAAGG + Intronic
1091600064 12:1912631-1912653 TGGACAGAGGAGCAGAAGGAGGG - Intronic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091663748 12:2403695-2403717 TGGACTGGAGAGATGGAGGAGGG - Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1092027540 12:5255326-5255348 TAGACACAGGAGTAGGATGACGG - Intergenic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092986613 12:13851925-13851947 TAGGCAGAGGAGGAGGAGGGTGG + Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093736542 12:22625871-22625893 TGGACTGGGGAGTGGGAGGAGGG - Intronic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1094167801 12:27460573-27460595 TAGACTGAGGAGGAGAAGCCGGG + Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094540982 12:31363047-31363069 AAGACTGAGGAGATGGAGGGAGG + Intergenic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096785155 12:54013107-54013129 AAGGCTGAGGAGGAGGAGGGTGG - Intronic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098762624 12:74444352-74444374 TAAACTGAAGAAAAGGAAGAAGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1099954994 12:89344905-89344927 TTCTCTGCGGAGAAGGAGGATGG + Intergenic
1100019774 12:90055306-90055328 TAGACTCATGAGATTGAGGAGGG + Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1100895868 12:99181944-99181966 TAGTGGGAGGATAAGGAGGAAGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101586592 12:106090663-106090685 TGGACTGATGAGGAGGCGGAGGG - Intronic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102618351 12:114174138-114174160 TAGACTGAGGTTTAAGAGGAGGG - Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102761194 12:115386880-115386902 TAGACTGAGACTAAGAAGGAAGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1103054622 12:117808938-117808960 TAGACTGGGGAGAAGGGGAGGGG - Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103477940 12:121232395-121232417 AAACCTGAGGGGAAGGAGGATGG - Exonic
1104135030 12:125929502-125929524 TAGACTGGGGAAGAAGAGGAGGG - Intergenic
1104417231 12:128605667-128605689 TCGGCTGAGGAGAAGGAAGTGGG + Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105546613 13:21355445-21355467 TAGCCTGGGGAGGGGGAGGAGGG + Intergenic
1105717527 13:23082093-23082115 TTGCCTGAGGAGGAGGAAGAAGG - Intergenic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106214371 13:27681667-27681689 TAGAGAGAGGAGAATGATGAGGG + Intergenic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106526120 13:30542654-30542676 GAGCCTGAGGAACAGGAGGAGGG - Intronic
1106526434 13:30544751-30544773 GAACCTGAGGAGAAGGAGGTGGG + Intronic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107135922 13:36944071-36944093 TTGGCTGAGGAGTAAGAGGAGGG + Intergenic
1107140209 13:36990691-36990713 TAGACTGAGCAGAAGTTGGGAGG - Intronic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107285232 13:38782923-38782945 TAGTGGGAGGAAAAGGAGGAAGG - Intronic
1107374854 13:39792547-39792569 TAGGCTGAGGAGGAGGAGAAAGG + Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107837401 13:44422994-44423016 TAGCCAGAGGCGAGGGAGGAGGG - Intergenic
1108005033 13:45937856-45937878 TAAACTGTGGAGAAGGAAGGTGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108454552 13:50599717-50599739 AAGACAGAGGAGAAGTGGGAGGG - Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109338146 13:61019078-61019100 TAGGCTGAGGGGCAGGAAGAAGG + Intergenic
1110284443 13:73733104-73733126 AAGACTGGGGGGAAGGAGTAAGG - Intronic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111364596 13:87225184-87225206 TAGGCTGTGGAGAAATAGGAAGG - Intergenic
1111448201 13:88378310-88378332 TAGAAAGAGGAGAGGGAGTATGG + Intergenic
1111523506 13:89435586-89435608 TAGACAGAGGACAAGGAAGATGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111666983 13:91281918-91281940 TTGACAGAGGATAAGGTGGAAGG + Intergenic
1112301845 13:98238268-98238290 TGGGCTGAGGAGGAAGAGGAGGG - Intronic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113174664 13:107548598-107548620 TAGATTGTGGAGGGGGAGGAAGG - Intronic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1113695032 13:112339238-112339260 AGGACTGAAGAGAAGGAGGGAGG - Intergenic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114365170 14:22018386-22018408 TAGTCTGTGGAGATGGAGAAAGG - Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114674641 14:24432018-24432040 TACGCTGTGGAGAAGGAGGGAGG + Exonic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1114972865 14:28056132-28056154 TGGGCTGAGGGGAGGGAGGAGGG - Intergenic
1115451887 14:33557364-33557386 AAGACAGAGGGGAAGTAGGATGG - Intronic
1115613638 14:35072401-35072423 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116132187 14:40869264-40869286 TAGGCTGAGGACGAAGAGGAAGG - Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116722857 14:48523071-48523093 TGGGCTGAGGAGGAAGAGGAGGG + Intergenic
1117184342 14:53225187-53225209 TAAACAAAGGAGAAGGAGAAAGG - Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117955210 14:61117540-61117562 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1118045772 14:61969463-61969485 GATACTGATGAGGAGGAGGAGGG + Intergenic
1118347907 14:64953041-64953063 CAGACTGTGGAGAGAGAGGAGGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1118635733 14:67747420-67747442 GAGACTGAAGGGAAGCAGGAGGG + Exonic
1119426529 14:74538940-74538962 TAAACTGAGGACAGAGAGGAGGG + Intronic
1119585729 14:75833073-75833095 TTGGCTGAGGAGAATGATGAAGG - Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120403191 14:84059263-84059285 TCATCTGATGAGAAGGAGGAAGG - Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1120780645 14:88482723-88482745 AATACTGATGGGAAGGAGGAGGG + Intronic
1121447505 14:93988150-93988172 TAGAAGGAGGAGTTGGAGGAGGG + Intergenic
1121460871 14:94076925-94076947 TAGGCTGAGTAGAAAGAGGAGGG - Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122180802 14:99953240-99953262 TAACCTGGGGAGAAGGTGGAGGG - Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122915890 14:104858826-104858848 TAGACGGTGGAGATGGAGGGTGG - Intergenic
1122916096 14:104859666-104859688 TGGACGGTGGAGATGGAGGATGG - Intergenic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1123677820 15:22729218-22729240 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1123879454 15:24662695-24662717 TAGAGTGTGGTGAAGCAGGAGGG + Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124330021 15:28803482-28803504 TAGGCTGAAGAAGAGGAGGAAGG + Intergenic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1125121233 15:36161147-36161169 AAGACTGAAGGGAAGAAGGAAGG + Intergenic
1125610218 15:40964441-40964463 TAGAATGAGGGAATGGAGGAGGG - Intergenic
1125715416 15:41817219-41817241 TGGACTGAGGATAAGGAGACAGG + Intronic
1126120166 15:45244506-45244528 TAGGCTGAGGAGGAGAAGGAAGG + Intergenic
1126212038 15:46111028-46111050 TAGACTGAGGTTAAGGAGTTTGG + Intergenic
1126292671 15:47099682-47099704 AACACTGAGGAGCAGGAGCATGG - Intergenic
1126939360 15:53749470-53749492 AAGACTGAGGAGAGGGAGAGAGG - Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128573859 15:68756146-68756168 TATGCTAAGGTGAAGGAGGAAGG + Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128675218 15:69603409-69603431 TGGAGTGTGGAGAAAGAGGAGGG + Intergenic
1129080407 15:73034365-73034387 TGGACTGAGGAGAAGGCTGTGGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129445546 15:75615342-75615364 TAGAGTTGGGAGAAGGAGTATGG - Intronic
1129743317 15:78000837-78000859 TAGATTGAAGAGAGGGAGGGAGG - Intronic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130880477 15:88051293-88051315 TGGAGTGGGGAGAAAGAGGAGGG - Intronic
1130903879 15:88226574-88226596 GGGCCTGAGGACAAGGAGGAGGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131271472 15:90950042-90950064 AAGCCTGGGGAGAGGGAGGAAGG + Intronic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132183420 15:99780429-99780451 GAGATGGAGGAGAGGGAGGAGGG + Intergenic
1132435015 15:101793052-101793074 GAGATGGAGGAGAGGGAGGAGGG - Intergenic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133332141 16:4981473-4981495 GAGACTGAGCAGTAGAAGGAAGG + Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133396709 16:5453129-5453151 TGGAGTGAGAAAAAGGAGGAAGG - Intergenic
1133647556 16:7778317-7778339 TAGATAGAGGAGATAGAGGATGG + Intergenic
1133850167 16:9495982-9496004 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134649585 16:15898158-15898180 GAGGTTGAGGAGGAGGAGGAGGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134745965 16:16588590-16588612 TAGACTGAAGAGCAGAAAGAGGG - Intergenic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134803593 16:17106915-17106937 TACTCTGAGGATGAGGAGGATGG + Exonic
1134999512 16:18765151-18765173 TAGACTGAAGAGCAGAAAGAGGG + Intergenic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135834350 16:25811288-25811310 TAGGCTGAGGAAGAGGAGGAAGG - Intronic
1135925394 16:26689507-26689529 TTGGCTGGGGAGAAGAAGGATGG + Intergenic
1136498514 16:30658448-30658470 TAGGCTGAGGAGGAAGAGGGAGG + Exonic
1137041614 16:35617786-35617808 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137602889 16:49768602-49768624 GAGACTGAGGAGATGGAGAAAGG - Intronic
1137616552 16:49851573-49851595 TTAACAGAGGAGGAGGAGGAGGG - Intronic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1139055100 16:63173846-63173868 AAGAGTGAGAAGCAGGAGGAGGG - Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139264306 16:65624693-65624715 GAGACAGAGGAGAAAGAGGGTGG - Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139466591 16:67157235-67157257 TGGATTGAGAAGAGGGAGGAGGG - Intronic
1139689297 16:68629688-68629710 TTGCCTGAGGAGCTGGAGGAAGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140102871 16:71933518-71933540 TAAACTGAACAGAAGGAGAAAGG + Exonic
1140655256 16:77133225-77133247 TAGACTGAGGACCAAGAGGAGGG + Intergenic
1140693125 16:77503858-77503880 GAGACAGAGAAGAGGGAGGAGGG + Intergenic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141061655 16:80878323-80878345 TAAACTGTGGAGAAGCAGCATGG + Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141624406 16:85253701-85253723 TAGCCAGGGGAGAAGGAGGGTGG + Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142320295 16:89377891-89377913 TTCATTGAGTAGAAGGAGGAGGG - Intronic
1142340204 16:89517020-89517042 TGGGCTGAGGAGGAGGACGAGGG + Intronic
1142472057 17:170132-170154 TGGACAGAGGGAAAGGAGGAAGG + Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143276125 17:5712226-5712248 GAGACAGATGAGCAGGAGGAGGG + Intergenic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143605947 17:7985942-7985964 GAGACTGAGAGGCAGGAGGACGG + Intergenic
1143659887 17:8318368-8318390 TATTCTGGGGACAAGGAGGAAGG - Exonic
1143711283 17:8736896-8736918 GAGACTGAGAAGAAGAAGAAAGG + Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1145302471 17:21650332-21650354 TATGCTGAGGAGGAGGATGATGG + Intergenic
1145857605 17:28177124-28177146 TAGGCTGAGGAGGAAGAGAAAGG + Intronic
1145922937 17:28624819-28624841 TAGACCTGGGAGAAGGAAGAGGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146954778 17:36931182-36931204 TAGACTGGGGAGAAGAGGCAGGG - Intergenic
1147036455 17:37685181-37685203 TAGATGGAAGAGAGGGAGGATGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148454157 17:47801938-47801960 GAGAATGAGGACAAGAAGGAAGG - Intergenic
1148482618 17:47970083-47970105 AAGACTGGGGACAAGGAGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149572029 17:57678712-57678734 TAGACTTAGATGAGGGAGGATGG - Intronic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149819851 17:59765685-59765707 GAGGCTGAGGAGGAGGCGGAGGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153546861 18:6216555-6216577 TAAACTGAAGAGATGTAGGAGGG - Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153807589 18:8722669-8722691 TAGATGGAGGAGGAAGAGGAGGG + Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1154031349 18:10756619-10756641 TAGATGGAGGATGAGGAGGAGGG + Intronic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1155753117 18:29454195-29454217 AAAACTGAGGAGAGGGAAGAAGG + Intergenic
1155789358 18:29946165-29946187 TAGGCTGAGGGGAAAGAGGAAGG + Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156088243 18:33434835-33434857 TAGATGTAGGAGAAGGAAGAGGG + Intronic
1156695314 18:39759371-39759393 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1156724729 18:40114223-40114245 TGGGCTGGGGAGAAGGGGGAGGG - Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1158532376 18:58275297-58275319 TAAGCTGAGGAGGAAGAGGAGGG + Intronic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159478322 18:68953762-68953784 TAGTCTGAGGAGAAGGCAAATGG + Intronic
1159540303 18:69766241-69766263 TAGACACTGAAGAAGGAGGAGGG + Intronic
1159669363 18:71203870-71203892 GAGACAGAGGAGAACAAGGAAGG - Intergenic
1159894034 18:73979919-73979941 TAGACAGAGGAGAGGGATAAGGG - Intergenic
1160011131 18:75107796-75107818 GAGTCGGAAGAGAAGGAGGAAGG - Intergenic
1160039252 18:75330969-75330991 TAGAAAGAGGAGAAGAAAGAAGG - Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160667662 19:340575-340597 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161195438 19:2983752-2983774 AGGACAGAGAAGAAGGAGGAGGG + Intronic
1161207101 19:3047010-3047032 AAAACTGAGGGGAGGGAGGAGGG - Intronic
1161218925 19:3108980-3109002 GAGACTGAGGGCAAGGAGGAAGG + Intronic
1161262886 19:3347221-3347243 GAGACTGAGGTGGATGAGGAAGG - Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161509558 19:4662976-4662998 TAAAATGAGGACAGGGAGGAGGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162283559 19:9719989-9720011 TAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1163813882 19:19452032-19452054 AAGACTCAGAAGTAGGAGGAGGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164216972 19:23159055-23159077 CAGACTGAGGAGAGTCAGGAGGG + Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164566025 19:29326689-29326711 AAGACAGTGGGGAAGGAGGATGG - Intergenic
1164592462 19:29514065-29514087 AAGAGGGAGGATAAGGAGGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164858646 19:31545021-31545043 GAGAAAGAGAAGAAGGAGGAGGG - Intergenic
1164864436 19:31592231-31592253 TAGACAGGGGTGAAGGAGGATGG - Intergenic
1165023738 19:32944383-32944405 TAGACTGAGGAGATGACGGGTGG + Intronic
1165416039 19:35694111-35694133 AAGAGGGAGGAGGAGGAGGAAGG - Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1166550273 19:43661221-43661243 TAGACTGAGAAGACGGAGGTTGG - Intronic
1167504434 19:49863644-49863666 TGGAGTGAGGAAAAGGAGGGGGG + Intronic
1167737016 19:51300915-51300937 TAGGCAGAGGGGATGGAGGAGGG + Intergenic
1167783379 19:51615529-51615551 TGGGGTGAGGAGAAGGAGAACGG + Intronic
1168165933 19:54547863-54547885 TAGACTCAGGAGACTGAGGCAGG - Intergenic
1168240295 19:55085822-55085844 GTGACTGAGGAGAAGCGGGAGGG - Exonic
1168402494 19:56093462-56093484 AACACTGAGGGGAAGGAGGACGG - Intronic
1168431074 19:56281220-56281242 TAGGCTGACCAGAAGAAGGAAGG + Intronic
1168510196 19:56967510-56967532 AGGAGGGAGGAGAAGGAGGAAGG - Intergenic
1168515647 19:57008545-57008567 TAGAGTCAGGTGAGGGAGGATGG + Intergenic
1168646812 19:58064412-58064434 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
925015321 2:519939-519961 TAGACTGTGAAGATGGAGGCAGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925715776 2:6782997-6783019 GAGCCTGATGGGAAGGAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926962850 2:18377899-18377921 TGGACTGAATGGAAGGAGGATGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
928232470 2:29510696-29510718 TAGACTGAGGAAACAGAGTATGG + Intronic
928266138 2:29813423-29813445 TGGATGGAGGAGGAGGAGGAGGG + Intronic
928299599 2:30113552-30113574 TAGACTGTGGGGCTGGAGGAAGG - Intergenic
928389258 2:30896800-30896822 GAGACAGAGGAGAAGAGGGAGGG - Intergenic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
928735350 2:34282453-34282475 GAGACTTCGGAGAAGAAGGAAGG - Intergenic
929168115 2:38904203-38904225 TAGACTTTGGAGAATGAGTAAGG + Intronic
929215652 2:39409082-39409104 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
929804261 2:45130854-45130876 TACACTCTGGAGGAGGAGGAAGG + Intergenic
929822206 2:45282706-45282728 TGGAAAGAGGAGAAGGAAGATGG - Intergenic
930330656 2:49979000-49979022 AAGACTTAGGGGAAGGAGGTCGG + Intronic
930355974 2:50320647-50320669 AACACAGAGGGGAAGGAGGAGGG + Intronic
930364627 2:50424123-50424145 GAGGCGGAGGAGGAGGAGGAGGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930762800 2:55053960-55053982 AAGACTGGAGAGAAGGAGAAGGG + Intronic
931003515 2:57819599-57819621 TTGACTGAGAAGATAGAGGAAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931541503 2:63334589-63334611 TAGAGTGAGTAGTAGGAGGCTGG + Intronic
931560344 2:63554834-63554856 GAGACTGAGGAAAAGCAGGGTGG + Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932115431 2:69042527-69042549 TAGACTGTGGGGAAGGAGCCAGG - Intronic
932911242 2:75808116-75808138 TAGACTGTGGAGGGGCAGGAGGG + Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933930344 2:87144049-87144071 GAAACTGAGGAGAAAGATGATGG + Intergenic
933985570 2:87589380-87589402 TAGACTGTGAAGGAGGAAGAAGG - Intergenic
934159197 2:89232067-89232089 GAGACTGTGAGGAAGGAGGAGGG + Intergenic
934208076 2:89950358-89950380 GAGACTGTGAGGAAGGAGGAAGG - Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
934655569 2:96115374-96115396 TCCACTGGGGAGAAGGAGGAGGG - Exonic
934930767 2:98420871-98420893 GAGACTGTGGAGCAGAAGGAAGG - Intergenic
935559840 2:104548611-104548633 TCACCTAAGGAGAAGGAGGAAGG - Intergenic
935721502 2:105983283-105983305 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
936031991 2:109079888-109079910 TAGACTGCTGAGAGGCAGGACGG + Intergenic
936308273 2:111361420-111361442 TAGACTGTGAAGGAGGAAGAAGG + Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936444050 2:112582309-112582331 TAGGCTGAGGAGAGGAAGGGGGG + Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937065845 2:119017031-119017053 TAGACAGAGAAGAAAGACGAGGG - Intergenic
937110333 2:119362068-119362090 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
937350918 2:121160823-121160845 GAGGCGGAGGAGAAGGAAGAAGG - Intergenic
937907407 2:127058955-127058977 AAGCCGGAGGAGAAGGAGGGAGG + Intronic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938999388 2:136716387-136716409 TAGAGTGAGGAGGATGAGGAGGG + Intergenic
939397912 2:141655096-141655118 TAAACTGGGGAGGAGGAAGAGGG + Intronic
939462299 2:142512876-142512898 TACACTATGGAGAAGGAAGAAGG + Intergenic
939911107 2:147984237-147984259 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
940090194 2:149906904-149906926 TTGACTGAAGAGAAGGATAATGG - Intergenic
940164050 2:150748370-150748392 AAGAAGGAGGAGAAGGACGAGGG - Intergenic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941473782 2:165923074-165923096 GAGACTTAGAAGAGGGAGGATGG + Intronic
941675199 2:168336885-168336907 TGGAGTGAGGAGGAGGAGGGAGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
942146922 2:173035907-173035929 TAGGCTCAGGAGGAGGAGAAGGG + Intronic
942299380 2:174547335-174547357 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
943103513 2:183514278-183514300 TAGGCTGAGGAGGAAGAGGAGGG - Intergenic
943693870 2:190901406-190901428 TAGACTGAAGAAGAAGAGGAGGG + Intronic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944932181 2:204530967-204530989 TAGAGTGAGGGAAAAGAGGATGG - Intergenic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945147135 2:206750204-206750226 GAGGCAGAGGAGAAGCAGGAAGG - Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
945275280 2:207982011-207982033 TAGGCTGAGGAGGAAGAGAAGGG - Intronic
945483416 2:210367695-210367717 TAGTCTGAGGAGAACTAGGAAGG + Intergenic
945523988 2:210866008-210866030 GAGAGTGAGGAAAAGCAGGATGG + Intergenic
945893855 2:215459991-215460013 GAGACAGAAGAGAAGGAGGGAGG - Intergenic
946427723 2:219608334-219608356 GGGAAGGAGGAGAAGGAGGAGGG + Exonic
946547835 2:220765056-220765078 AAGAGTGAGGAAATGGAGGAAGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946866825 2:224048494-224048516 AAGAATGAGGAAAAGGAAGAGGG + Intergenic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947619507 2:231580593-231580615 AAGAGGGAGGAGGAGGAGGAGGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947894765 2:233659557-233659579 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948707182 2:239802209-239802231 TTGGCTGAGGAGTAGCAGGAAGG + Exonic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1168824183 20:798241-798263 TAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170389740 20:15859206-15859228 TGGGCTGAGGAGGAAGAGGAAGG + Intronic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171519094 20:25762080-25762102 GAGACTGATGATAATGAGGATGG + Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172119226 20:32588026-32588048 GAGACTGAAGTGAGGGAGGAGGG + Intronic
1172705363 20:36878665-36878687 GAGACGGAGGATCAGGAGGAGGG + Intronic
1172956564 20:38763847-38763869 TAATCTGAGGAGGAGGAAGATGG - Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173134066 20:40423801-40423823 AAGACTGAAGAAGAGGAGGAAGG + Intergenic
1173138322 20:40459731-40459753 TAGGATGAGGAGTAGAAGGAAGG + Intergenic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173538983 20:43837603-43837625 TAGGCTGGGGAGGAAGAGGAGGG + Intergenic
1173835639 20:46123498-46123520 AAAACTGAGGAGAAGCAGGAGGG - Intronic
1174394681 20:50239655-50239677 TAGAATGATGAGAAGGAGCTGGG + Intergenic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174618236 20:51853102-51853124 TAGCCTGAGGAGGTGGAGGTGGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1174988857 20:55487191-55487213 GAGACTGAGGAAAACCAGGAGGG + Intergenic
1175954743 20:62603532-62603554 TGGCCTGGGGAGAAGGGGGAAGG + Intergenic
1176231090 20:64033286-64033308 AAGACTGTGGAGAAGGTGGTAGG + Intronic
1176249157 20:64112080-64112102 TGCACTGTGGAGCAGGAGGAAGG + Intergenic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176515851 21:7782899-7782921 TAGAATGAGGGCAAGGATGAAGG - Intergenic
1176549359 21:8214667-8214689 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176557252 21:8258890-8258912 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176576194 21:8441925-8441947 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176582363 21:8543378-8543400 GACACTGAGGAGCAGGAGCATGG - Intergenic
1177182517 21:17758461-17758483 GAGACAGAGGAACAGGAGGATGG - Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1178649879 21:34412911-34412933 TAGAATGAGGGCAAGGATGAAGG - Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1179065912 21:38024775-38024797 TGCACTGATGAGAAGGAGAAGGG + Intronic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179364714 21:40747315-40747337 TAGACTAAGGAAAAAGAGAAAGG + Intronic
1179730779 21:43366136-43366158 TAAACTGTGGAGACAGAGGAAGG + Intergenic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1180113822 21:45682675-45682697 TAGACTGACAAGCAGGAGAATGG + Intronic
1180265198 22:10520426-10520448 GACACTGAGGAGCAGGAGCATGG - Intergenic
1181091038 22:20472815-20472837 TGGAATGATGAGAAGGAGCAGGG + Intronic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181675548 22:24449226-24449248 AAGACAGAGGATTAGGAGGAGGG + Intergenic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182414129 22:30210181-30210203 AAGACTGAGGATAAGTGGGAGGG + Intergenic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1184244035 22:43226957-43226979 GAGGCTGAGGGGGAGGAGGAGGG - Intronic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1184567268 22:45299491-45299513 TACCCTGAGGAGGACGAGGAAGG - Intergenic
1184612450 22:45613404-45613426 TAGGCTGAAGGGGAGGAGGATGG - Intergenic
1184620356 22:45672020-45672042 GAGCCTGACGAGGAGGAGGAAGG - Exonic
1203254244 22_KI270733v1_random:130983-131005 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203262300 22_KI270733v1_random:176062-176084 GAGACGGGGGAGGAGGAGGACGG - Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949372054 3:3346065-3346087 TAGACTGTGGAGAATGAGAAAGG + Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950167627 3:10813820-10813842 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950167643 3:10813909-10813931 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950394016 3:12719684-12719706 GAGACAGAGGAGAAGGAGAGAGG + Intergenic
950402230 3:12778148-12778170 TGGACTGAGGAAAAGGAAAAAGG - Intergenic
950454385 3:13083998-13084020 TGGACTGAGGGGAGGGCGGAAGG + Intergenic
950575945 3:13832126-13832148 GAGCCTGAGGAGGAGGAAGAGGG - Intronic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
950997715 3:17521303-17521325 TAGGCTGAGGAGGAGGTGGAAGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952488425 3:33840322-33840344 TAGGCTGAGGAAGAGGCGGAAGG + Intronic
953279235 3:41536724-41536746 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953680744 3:45036230-45036252 AGGACTGAGGAGAGGAAGGAGGG + Intergenic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955347659 3:58173108-58173130 GAGACAGAGGAGGAGGAGGTGGG - Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955947568 3:64210040-64210062 TAGACAGTGGTGGAGGAGGAGGG - Intronic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
956874107 3:73445032-73445054 TAGGCTGAAGTGAAGCAGGAAGG + Intronic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957755660 3:84483081-84483103 GAGGCTGAGGGGAAAGAGGATGG + Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958260577 3:91376004-91376026 TCGACTGAGGAGATCAAGGAAGG + Intergenic
958264841 3:91426180-91426202 TTGACTGAGAAGAAGCAAGAGGG - Intergenic
959670469 3:108971575-108971597 TAGACTGGGGAGAGGAAGGTGGG + Intronic
959890866 3:111554711-111554733 TAGACTGTGGTGGAGGGGGATGG + Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
960836439 3:121911459-121911481 TAAATGGAGGAGGAGGAGGAGGG - Intronic
960962779 3:123083860-123083882 TAGACTGAAGTGGAGGAGAAAGG + Intronic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962545472 3:136429776-136429798 TACACTGGGGAGGAGGAAGAGGG - Intronic
962625586 3:137222653-137222675 TAAAATGAGTACAAGGAGGAAGG - Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963291448 3:143494168-143494190 TAAACTGATAAGAAGGAAGATGG - Intronic
963677964 3:148337674-148337696 TAGTCAGGGGAAAAGGAGGATGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
963943207 3:151115957-151115979 GAGGCTGAGGAAAAGGAGAATGG + Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965210281 3:165777776-165777798 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966643179 3:182213214-182213236 TAGACTGAGAAGGAAGAGAAAGG - Intergenic
966937397 3:184719974-184719996 GAGACTCAAGGGAAGGAGGAAGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967145730 3:186604365-186604387 GAGACTGAGGCGTGGGAGGATGG - Intergenic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968557653 4:1255689-1255711 TGCACTGGGGAGAAGGAGGAGGG - Intergenic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970122903 4:12777265-12777287 TGGACTAAGGTGAAGGAGGCAGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970648645 4:18152739-18152761 TAAACTCAGGAGAATGAGGCAGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971361993 4:25946627-25946649 TAGGCAGAGGAGGAGAAGGAGGG + Intergenic
972086123 4:35218870-35218892 TAGGCTGAGGAGAAGAAAGAGGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
972687935 4:41369183-41369205 TAGACTGGGAAGATGGGGGAGGG - Intronic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973233337 4:47867638-47867660 AAGATGGAGGAGGAGGAGGAGGG + Intronic
973612657 4:52651295-52651317 TGGAGGGAGTAGAAGGAGGAGGG + Intronic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
975039673 4:69730147-69730169 TTCACTGAGGAGCAGAAGGAAGG + Intronic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975567825 4:75778419-75778441 TAGGCTGAGGAGCAAAAGGAAGG + Intronic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
976426845 4:84913906-84913928 TAGGCTGAGGAGGAAGAGAAGGG - Intronic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976500790 4:85786724-85786746 AAGCCTGAGGGGAAGGAAGAAGG - Intronic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977428174 4:96896364-96896386 TACATTGAGGAGAAAGAGCAGGG + Intergenic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
977855464 4:101885338-101885360 TAAACTGGAGAGAAGGAGAAGGG - Intronic
978314163 4:107417597-107417619 TAGTCTGAGGAGAGTCAGGAGGG - Intergenic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978740137 4:112127742-112127764 TACACAGAGGAGAAGCAGGGTGG - Intergenic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979039159 4:115764742-115764764 AAGCCTGAGGAACAGGAGGAAGG - Intergenic
979397479 4:120205957-120205979 TAGACTGAAGAGGAAGAGGGTGG + Intergenic
979450900 4:120870119-120870141 AAGACGGAGGAGACAGAGGAAGG + Intronic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
980591326 4:134893237-134893259 TATACTGAGGAGTTTGAGGATGG - Intergenic
980907553 4:138962981-138963003 TAGGCTGAGGAGGAAGAAGAGGG + Intergenic
981197744 4:141940893-141940915 CATACTGATGAGGAGGAGGAAGG - Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
981359814 4:143833223-143833245 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981370581 4:143954302-143954324 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981380347 4:144064222-144064244 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981495484 4:145386983-145387005 TAGGCTGAGGAGGAAGAAGAGGG + Intergenic
982088138 4:151857190-151857212 TAGCATGAGGGGAGGGAGGAGGG - Intergenic
982473943 4:155827295-155827317 TAGGCTGAGGAGGAGGAGACAGG - Intergenic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
983383547 4:167027803-167027825 TAAGCCGAGGAGGAGGAGGAAGG + Intronic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
984080915 4:175249025-175249047 TAGATTGAGGACAATGAGAAGGG + Intergenic
984171326 4:176362744-176362766 TAGAGAGGGGAGAAGGAGAAGGG - Intergenic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984257052 4:177401643-177401665 TAGAAACAGGAGAGGGAGGAGGG - Intergenic
984479072 4:180275715-180275737 GGGACAGAGAAGAAGGAGGAAGG + Intergenic
984692686 4:182745932-182745954 TGGACAGAGGAGAAGGATTATGG - Intronic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984881616 4:184414444-184414466 GAGGCTGAGGTGTAGGAGGATGG - Intronic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985535108 5:460311-460333 TAGACTGAGGAGGAGGCTGAGGG - Intronic
985923907 5:3000785-3000807 TAGGCGGTGGAGAAGGAGTAGGG + Intergenic
985985747 5:3515015-3515037 TTCACTGATGAGGAGGAGGATGG - Intergenic
986009734 5:3701177-3701199 GAGAAGGAGGAGAAGAAGGAGGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986337170 5:6763776-6763798 TGGACAGAGGTGGAGGAGGAGGG - Intergenic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987114971 5:14718925-14718947 GAGACAGAGCAGAAGGATGAAGG + Intronic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987384550 5:17316714-17316736 GAGACAGAGGAGGAGGATGAAGG - Intergenic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
987916358 5:24220004-24220026 TAGACTCAGAAGAGGGAGGATGG - Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988296027 5:29363379-29363401 TAAGCTGAGGAGGAGGAAGAGGG + Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988573453 5:32395677-32395699 TAGGCTGAGGAAGAAGAGGAGGG - Intronic
988709421 5:33758612-33758634 AATTCTGAGCAGAAGGAGGAAGG + Intronic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989553577 5:42764384-42764406 AAAACAGAGGAGGAGGAGGAGGG + Intronic
989684922 5:44074428-44074450 CATACTGAGGAAAAGGAAGAAGG + Intergenic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990432518 5:55750436-55750458 TATTCTCAGGAGGAGGAGGAGGG + Intronic
990780245 5:59352783-59352805 TAGACTGAACAGTAGAAGGAAGG - Intronic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
992680204 5:79145446-79145468 TAGCATGGGGAGAGGGAGGAGGG - Intronic
992737867 5:79742021-79742043 AAGAGGGAGGAGGAGGAGGAAGG - Intronic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993347505 5:86802888-86802910 TAAACTGAGGAAGAGGAGGAAGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
994974651 5:106786944-106786966 AAGACTGAGAGGAAGGAGTATGG - Intergenic
995195233 5:109359066-109359088 TAAGCTGAGGAGGAAGAGGAGGG - Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
996407137 5:123116800-123116822 TAGACTGGGGAGAAATAGTAAGG + Intronic
996445031 5:123537949-123537971 TAGACTGAGGAAAAGAAGTCAGG - Intronic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997420212 5:133760729-133760751 TAGAGTGAGAAAAAGGAAGAGGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999337294 5:150733034-150733056 AAGTCTGAGAAGAAGGAGGTGGG - Intronic
999375976 5:151086865-151086887 AAGACAGTGGAGAAGGAGGCTGG + Intronic
999433064 5:151540475-151540497 GAGAGTGAGGAGCAGGAGAAGGG - Intronic
999558879 5:152776833-152776855 TGGAGTGAGGGGATGGAGGAGGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1000014450 5:157265577-157265599 TGCTCTGAGGAGAAGGAGCAGGG - Intergenic
1000267728 5:159653783-159653805 TAAAGGGAGGAGAAGGAGCATGG + Intergenic
1000734781 5:164885695-164885717 TAGAGGGTGGAGAAAGAGGAGGG + Intergenic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1001252229 5:170155180-170155202 AAGCATGAGGAGAAGGATGAGGG + Intergenic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1002930561 6:1631664-1631686 TGGATTGGGGAGAAGGAGGAAGG - Intronic
1002934744 6:1661953-1661975 TACACTGGGGAGATGGAGGAAGG + Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003355518 6:5365948-5365970 TAGGCTGAAGAGGAAGAGGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003578688 6:7319992-7320014 TAGACTGAGAAGAAAATGGAGGG - Intronic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003781951 6:9439228-9439250 TAGGCTGAGAAGGATGAGGAGGG + Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004120363 6:12815747-12815769 TAGACTGGGGAAAAGGACAAAGG - Intronic
1004173202 6:13315248-13315270 TAGGCTGAGCAGGAGGAGGGAGG - Intronic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004744832 6:18499434-18499456 TTGAGTGCTGAGAAGGAGGAGGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1007340972 6:41191466-41191488 TATCCTGAGGGGTAGGAGGAGGG + Exonic
1007685982 6:43667681-43667703 AGGACAGAGGAGGAGGAGGAGGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1008660077 6:53658564-53658586 TAGACCGAGGAGAGGGTGGAAGG + Intronic
1008990543 6:57596480-57596502 TTGACTGAGAAGAAGCAAGAGGG + Intronic
1009179116 6:60495026-60495048 TTGACTGAGAAGAAGCAAGAGGG + Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009571397 6:65390148-65390170 TGGACTGAGGTGAAGGAGAGGGG + Intronic
1009633815 6:66236718-66236740 TAGAGTGAGTATAAGGAAGAGGG - Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010445488 6:75944255-75944277 AACAGTGAGGGGAAGGAGGAAGG - Intronic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013263662 6:108472212-108472234 TTGAGTGAGGAGAAGGGGAAGGG + Intronic
1013437649 6:110127809-110127831 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013628841 6:111965078-111965100 GAGGCGGAGGAGGAGGAGGAGGG + Intergenic
1013700906 6:112768245-112768267 TGGACTGAGGAGAAGCAGACAGG - Intergenic
1013760420 6:113511327-113511349 CAGACAGAGGAAAAGGAGCATGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014279503 6:119425255-119425277 TAGACTGTGGAGGAGCAAGAAGG + Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014757334 6:125315946-125315968 GAGACAGAGAAGGAGGAGGAGGG + Intergenic
1014762710 6:125375207-125375229 TAAACAGAGGAAAAGAAGGAAGG - Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1015881369 6:137873323-137873345 GAGACTGCGGTGAATGAGGAAGG + Intronic
1016014340 6:139168240-139168262 TATCCTGAGAGGAAGGAGGAGGG - Intronic
1016126907 6:140414929-140414951 AGGACTGGGGAGAAGGAGGGAGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016689505 6:146920253-146920275 TAATCTGAGGATAAGTAGGAGGG + Intergenic
1016714927 6:147214411-147214433 TAAGCTGAGGTGAAGGAGGTAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017058144 6:150456234-150456256 AGGACTGAGGAGAAGGAAGAGGG - Intergenic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017492527 6:154956915-154956937 TAGACAGAGGAAAAGGGGAATGG + Intronic
1017516143 6:155157240-155157262 TAGACGGGGGTGAAGCAGGAAGG - Intronic
1017589372 6:155961993-155962015 TGGTCTGAGGAGAAGAAGGATGG + Intergenic
1017866588 6:158449241-158449263 TAGACTGATGTGGAGGAGGGAGG + Intronic
1018217368 6:161542037-161542059 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018658881 6:166066967-166066989 TAGAATGAGAAGAAGCAGGTAGG - Intergenic
1018687085 6:166311649-166311671 TAGGCTGAGGAGGAAGCGGAGGG - Intergenic
1018962351 6:168457814-168457836 TAGACTCATTAGAAAGAGGAGGG - Intronic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019046139 6:169147717-169147739 AAGACTGAGGCAAAGGAGGGTGG + Intergenic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020125517 7:5530786-5530808 GAGATTGAGGAAGAGGAGGAGGG + Intronic
1020439765 7:8204971-8204993 TACACTAAGGATAAGGAAGAGGG + Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020677308 7:11197456-11197478 TAGATTAAGGATAAGGATGAAGG - Intergenic
1020808055 7:12815034-12815056 TAGGCTAAGGAGAAGGTGCATGG + Intergenic
1020868141 7:13591481-13591503 GAGAGTGAGGAAAAGCAGGATGG - Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021301643 7:18980799-18980821 GAGACGGAGGAGAAGGAAGAAGG - Intronic
1021746594 7:23746730-23746752 TAGGCTGAGGAGGAAGAGCATGG + Intronic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022145874 7:27539966-27539988 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1022399095 7:30018964-30018986 TAGAAAGAGGAGTAGGAAGAAGG + Intronic
1022691189 7:32656909-32656931 TAGATAGAGGAAAAGAAGGAAGG - Intergenic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023156373 7:37256505-37256527 TGGAGGGAGGAGAAGGAGGAAGG + Intronic
1023296765 7:38723133-38723155 TAGGCTGAGAAGGAGGAGGAAGG + Exonic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023727902 7:43163444-43163466 AAGACTGGGGAGATGGAGGCAGG + Intronic
1023745139 7:43316190-43316212 TAAACTGAGGAGCAGGTGGTAGG + Intronic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024250908 7:47505122-47505144 TCGGCTGCGGAGTAGGAGGAGGG - Intronic
1024465299 7:49705915-49705937 TACACTGTAGAAAAGGAGGAGGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025887763 7:65614474-65614496 GAGATGGAGGAGGAGGAGGAAGG - Intergenic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026401827 7:70021682-70021704 CAGATTGAGGAGCAGCAGGAAGG - Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026484777 7:70808452-70808474 TAGACACTGGAGAAGGAAGAAGG + Intergenic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1027544005 7:79503715-79503737 TAGACTGAGGAAGAGGAGAAGGG + Intergenic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028754695 7:94421772-94421794 TAGACCAAGGAGTAGGAGGTAGG - Intronic
1028889310 7:95969252-95969274 AAGACTGAAGATAAGGAAGATGG + Intronic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029351099 7:100013496-100013518 TAAGCTGAGGAGGAAGAGGAAGG - Intergenic
1029361350 7:100090528-100090550 GAGAATGAGGGGAAGGAGAAAGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029857240 7:103529663-103529685 TGGTCTGAGGAGAAATAGGAAGG - Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030147021 7:106367301-106367323 TAGACTGAGCAGGAAGAGAATGG - Intergenic
1030235995 7:107262719-107262741 TCAACTGAGAATAAGGAGGAGGG - Intronic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1031959167 7:127973461-127973483 TAGATTGAGAAGAGGTAGGAAGG + Intronic
1032121232 7:129158534-129158556 TAGAGTGAAGGGTAGGAGGAAGG - Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032962037 7:137046853-137046875 TAAACACAGAAGAAGGAGGAGGG + Intergenic
1033205181 7:139414134-139414156 TAGAATGAGGTGAAGAAGGGGGG - Intronic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033295730 7:140132786-140132808 AAGACTGAGGAGAAATAGCAGGG + Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034238780 7:149593527-149593549 TAGGCTGAGGAGGAGGATGAGGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034779366 7:153863729-153863751 TGGTCTGGGGAGTAGGAGGAAGG - Intergenic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035239566 7:157520929-157520951 GAGACTGGGGAGGAGGAGGGTGG + Intergenic
1035416887 7:158696723-158696745 TGGACTTAGGAGGAGGAGGGTGG - Intronic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035668327 8:1396003-1396025 ACGACTCAGGAGAACGAGGAGGG - Intergenic
1035669025 8:1402236-1402258 ACGACTCAGGAGAACGAGGAGGG - Intergenic
1035760441 8:2064761-2064783 GGGATGGAGGAGAAGGAGGAGGG - Intronic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036273323 8:7327793-7327815 GAGGCTGAGAAGAAAGAGGAAGG + Intergenic
1036348026 8:7982559-7982581 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036383428 8:8255574-8255596 TAGGCAGTGGAGCAGGAGGAAGG - Intergenic
1036806434 8:11837545-11837567 TAGACTGTAGAGAGGGAGGTGGG + Intronic
1036843321 8:12143035-12143057 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036864685 8:12385350-12385372 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037494758 8:19428031-19428053 GATCCAGAGGAGAAGGAGGAAGG - Intronic
1037613819 8:20499037-20499059 TAGGCTGAGGAGGAAGATGAGGG - Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1037870402 8:22489379-22489401 TATACTGGGGAGAGGGAGTAAGG - Intronic
1038076717 8:24084109-24084131 TAGACTTAGTAGCATGAGGATGG - Intergenic
1038240093 8:25800453-25800475 GAGACTGAGCAGAAGGAATATGG - Intergenic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038324818 8:26564924-26564946 GAGACTCAGAAGAAGGAGGGTGG - Intronic
1038344533 8:26719990-26720012 TGCACTGAGGAGATGGAAGAGGG - Intergenic
1038400331 8:27279656-27279678 TAGACAGGGGAGAGGGAGGAAGG + Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038485710 8:27933772-27933794 AAGACTGAGGAGCAAGAGAATGG + Intronic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039103896 8:33970066-33970088 TTGCCTGAGGAGAGGGTGGATGG + Intergenic
1039967605 8:42294538-42294560 TTGACAGAGGAGAAGCAAGAAGG + Intronic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040765761 8:50908925-50908947 TAAATTGAGGAGTAGGAAGAAGG + Intergenic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1040982944 8:53264146-53264168 TACACTCTGGAGATGGAGGAAGG + Intergenic
1041191218 8:55356849-55356871 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042154929 8:65834178-65834200 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042382297 8:68130962-68130984 TAGGCAGAGGAGAAGGACAAGGG + Intronic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1042847265 8:73180971-73180993 TAGACTGTAGAGAAAGGGGAGGG - Intergenic
1043094184 8:75945783-75945805 TAGGCTGAGGAAGAGGAAGAGGG - Intergenic
1043245960 8:78001768-78001790 TACACAGAAGAAAAGGAGGATGG + Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1044463109 8:92470528-92470550 TTGACTTATGAGATGGAGGAGGG - Intergenic
1044966347 8:97577437-97577459 AGGACAGAGCAGAAGGAGGATGG + Intergenic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045258811 8:100553293-100553315 AAGACTGAGGAGAGGGCAGAGGG + Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045522285 8:102913887-102913909 TAGTCTGAGGGGAAGGAGCCAGG + Intronic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1047906686 8:129480260-129480282 GTGACAGAGGAGAAGGGGGAGGG - Intergenic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048479786 8:134778495-134778517 TAGACTGACGAGCAGATGGATGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048752663 8:137697637-137697659 TTGATTGAGGAGCAGGAGGTCGG - Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049350675 8:142162877-142162899 AAGAGAGAGGAGATGGAGGATGG + Intergenic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050150571 9:2615840-2615862 TAGACTTAGGAGAAGTCAGATGG - Intergenic
1050412627 9:5382567-5382589 TCGACTGAGGTAATGGAGGAAGG + Intronic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050942177 9:11473203-11473225 TAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051489711 9:17647919-17647941 TAGGCTGAGGTGGAAGAGGAAGG - Intronic
1052043671 9:23769934-23769956 TAGACTGAAGAGAAGGACTTGGG - Intronic
1052559422 9:30065420-30065442 TATGCTGAGGAGGAAGAGGAGGG + Intergenic
1052872468 9:33521662-33521684 GAGACTGGGGAGAGGGAGCAAGG - Intergenic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1053885925 9:42645209-42645231 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054224943 9:62452658-62452680 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055413758 9:76060457-76060479 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1055930585 9:81555926-81555948 TAGAAGGAGGAGAGGAAGGAGGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057307889 9:93922756-93922778 AAGACAGAGAAGAAGGAAGAGGG + Intergenic
1057570787 9:96202868-96202890 TGGATTGAGGAGAATGAGAAGGG + Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059465026 9:114463344-114463366 GAGACTGGGGAGAAGGAAAATGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059737722 9:117118895-117118917 TAGAGTGAGGAGGTGGAGGAAGG - Intronic
1059961925 9:119574009-119574031 AAGACTGAGATGAAGGAGGCAGG - Intergenic
1060135322 9:121147921-121147943 CAGACTGAGAAGGAGAAGGAGGG + Intronic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1061133535 9:128721200-128721222 TGGGCTGAGGAGGAGGAAGAGGG - Exonic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061968467 9:134029749-134029771 TAGACTGAGGTGCAGAGGGAGGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1202629276 M:3317-3339 TACAATGAGGAGTAGGAGGTTGG - Intergenic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1203470645 Un_GL000220v1:114127-114149 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203478466 Un_GL000220v1:158099-158121 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1185460722 X:331807-331829 GAGACGGAGGAGACGGAGAAGGG - Intergenic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185934516 X:4240680-4240702 TACACTGAGAAGAAACAGGAAGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186294110 X:8130166-8130188 TTGACAGAGGAGAAGATGGAAGG + Intergenic
1186368770 X:8925372-8925394 TAGGCTGAAGAGGAAGAGGAAGG + Intergenic
1186389305 X:9142832-9142854 TTAACTCAGGAGAAGCAGGATGG + Intronic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1186751631 X:12627500-12627522 GAGCCTGAGGAGAAAGAGGTTGG + Intronic
1187342773 X:18436223-18436245 TAGGCTGAGGAGGAAGAGGGAGG + Intronic
1187547618 X:20267959-20267981 TGGGCGGAGGAGGAGGAGGAGGG + Intergenic
1187737980 X:22323816-22323838 TGGAAAGAGGAAAAGGAGGAGGG - Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189354036 X:40298181-40298203 TCGGCAGAGGAGGAGGAGGAAGG + Intergenic
1190404597 X:50074036-50074058 GAGGCTGAGGACAAGGAAGATGG + Intronic
1190772286 X:53525406-53525428 TAGGCTGAAGAGGAAGAGGAGGG - Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1192198948 X:69051722-69051744 TGGACTGAGGAGCAGGTAGATGG - Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1192995659 X:76510024-76510046 GAGATTGAGGTGTAGGAGGAGGG + Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195321288 X:103724002-103724024 AAGACTGAGGGGTGGGAGGAGGG - Intronic
1195455505 X:105064763-105064785 TAGGCTGAGGAGGAGGAAAAGGG + Intronic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1196229380 X:113203229-113203251 TAGAGTGAGGAAAAGTAGGGTGG - Intergenic
1197114170 X:122812657-122812679 TAGACTAAGGAGGAGAAAGAAGG - Intergenic
1197407583 X:126071141-126071163 TATACTGAGGAGTGGGAAGAAGG + Intergenic
1197714640 X:129697573-129697595 TAGGCTGAAGAGATGGGGGAGGG + Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1199987421 X:152962682-152962704 TACACTGAGGTGAGGTAGGAGGG + Intronic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1200744093 Y:6888130-6888152 GAGACTGTGGAGAAATAGGAAGG - Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1201716245 Y:17047046-17047068 TAAACAGAGGAGAAACAGGAAGG + Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic