ID: 951558718

View in Genome Browser
Species Human (GRCh38)
Location 3:23945566-23945588
Sequence TCACCTCCATGGTGCCCTCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951558718_951558722 1 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558722 3:23945590-23945612 TGCAGGTAAGAACCGGACTGCGG 0: 1
1: 0
2: 0
3: 6
4: 90
951558718_951558728 11 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558728 3:23945600-23945622 AACCGGACTGCGGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 5
4: 80
951558718_951558726 9 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558726 3:23945598-23945620 AGAACCGGACTGCGGCGGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 44
951558718_951558730 15 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558730 3:23945604-23945626 GGACTGCGGCGGGTGGGGGATGG 0: 1
1: 0
2: 2
3: 89
4: 745
951558718_951558721 -6 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558721 3:23945583-23945605 AGGTGAATGCAGGTAAGAACCGG 0: 1
1: 0
2: 1
3: 20
4: 226
951558718_951558727 10 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558727 3:23945599-23945621 GAACCGGACTGCGGCGGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 70
951558718_951558731 19 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558731 3:23945608-23945630 TGCGGCGGGTGGGGGATGGCCGG 0: 1
1: 0
2: 5
3: 58
4: 560
951558718_951558733 23 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558733 3:23945612-23945634 GCGGGTGGGGGATGGCCGGAGGG 0: 1
1: 0
2: 1
3: 45
4: 716
951558718_951558725 8 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558725 3:23945597-23945619 AAGAACCGGACTGCGGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 51
951558718_951558723 4 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558723 3:23945593-23945615 AGGTAAGAACCGGACTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 53
951558718_951558724 5 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558724 3:23945594-23945616 GGTAAGAACCGGACTGCGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 34
951558718_951558732 22 Left 951558718 3:23945566-23945588 CCGCGAGGGCACCATGGAGGTGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 951558732 3:23945611-23945633 GGCGGGTGGGGGATGGCCGGAGG 0: 1
1: 0
2: 9
3: 120
4: 1000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951558718 Original CRISPR TCACCTCCATGGTGCCCTCG CGG (reversed) Exonic
900949853 1:5852574-5852596 TTATCCCCATGGTGCCCTCAGGG + Intergenic
901053998 1:6440305-6440327 TCACCTCCAGGTGGCCCTCCTGG - Exonic
901358571 1:8675082-8675104 TCAAATCCATGGGGCCCTGGGGG + Intronic
901741531 1:11345172-11345194 TTACCTGGCTGGTGCCCTCGGGG - Intergenic
902330134 1:15727271-15727293 ACACCTCCATGGAGCGCTTGGGG + Exonic
902480293 1:16708005-16708027 TCACCTCCAGGTGGCCCTCCTGG + Intergenic
903006565 1:20302738-20302760 CCACCTCCATGGAGCCTTCTCGG - Intronic
903215463 1:21841241-21841263 TCACCCACACGGGGCCCTCGGGG + Exonic
903257263 1:22111246-22111268 TCCCCTCCACTGTGCCCTCAAGG - Intergenic
903299167 1:22365752-22365774 TTACCTCCATGCTGTTCTCGTGG + Intergenic
903662099 1:24984505-24984527 CCACCTCCATGCAGCCCTCCAGG - Intergenic
912421333 1:109544138-109544160 TCTCCTCAATGGAGCCCTCCCGG - Exonic
915070545 1:153261891-153261913 TCGCCTCCGTGGTACCCTGGGGG - Exonic
920250298 1:204618540-204618562 GCAGCTCCAGGGTCCCCTCGGGG + Exonic
921177802 1:212608912-212608934 TCACCTCCAGGCTCCGCTCGGGG - Exonic
1063266166 10:4453498-4453520 TCAGCTCCTTGTTGTCCTCGGGG + Intergenic
1068920244 10:62475729-62475751 ATCCCGCCATGGTGCCCTCGGGG - Intronic
1069861457 10:71474206-71474228 TCACCTCCAGGGAGCCCTCAGGG + Intronic
1070654546 10:78262369-78262391 TCACCTTCATGGCTCCCTAGTGG - Intergenic
1071943087 10:90610155-90610177 TCACCTCTAGGGTCCCCCCGAGG + Intergenic
1073330311 10:102666153-102666175 TCACCTCTGTGCAGCCCTCGTGG + Intergenic
1074180579 10:111059451-111059473 ACGCCTCCATGCTGCCCTCCTGG - Intergenic
1076421805 10:130337206-130337228 CCTCCTCCATGCTGCCCTCCTGG + Intergenic
1076750101 10:132538084-132538106 TCCCCGCCATGGTGCCCGGGCGG - Exonic
1077240537 11:1508317-1508339 TCACCTCCATGCGTCTCTCGGGG - Intergenic
1077240571 11:1508414-1508436 TCACCTCCATGCGTCTCTCGGGG - Intergenic
1078112004 11:8402699-8402721 TGGCCACCATGGTGCCCTCCAGG + Intronic
1079499101 11:21082214-21082236 TCACCTGAATGGAGCCCTCTAGG - Intronic
1079649039 11:22903395-22903417 GCACCTCCATGATTCCCTAGAGG - Intergenic
1083476071 11:62916503-62916525 TCACCTCCAAGGACCCCTCTAGG - Intronic
1085197400 11:74680884-74680906 TCTCCTCCATGGTGGCATCCGGG + Intergenic
1089010731 11:115129628-115129650 TCACCTCCAGGTTGAACTCGGGG + Intergenic
1089212403 11:116814374-116814396 ACACCTCCCTGGTGCCCACAGGG + Intergenic
1092077657 12:5686649-5686671 TCCCCTCCATGGGCCCCTCTGGG + Intronic
1092114000 12:5985530-5985552 TCCCCTCCCTGGTGCCTTCATGG - Intronic
1095842749 12:46712326-46712348 TCACCTCCATGTTTCCATCTTGG + Intergenic
1101824073 12:108207154-108207176 TCAGCCCCATGGTGCCCCCAGGG - Intronic
1110187630 13:72693379-72693401 TCCCCTCCACAGTGCCCTAGTGG - Intergenic
1113148879 13:107239923-107239945 TGACCACCATGATGCCCTTGTGG - Intronic
1114438863 14:22730166-22730188 TGACCTCCACGGTCCCCTCTTGG + Intergenic
1118316542 14:64729463-64729485 TCATCTCCAGGGAGCCCTTGGGG - Intronic
1120124801 14:80728904-80728926 TCACTTCCATGCTGCCAACGCGG + Intronic
1126868022 15:52957385-52957407 CCACCTCCCTGGTTCCCTCCAGG - Intergenic
1127095584 15:55509143-55509165 TTACCTCCATGCTGCTCTTGTGG - Intergenic
1129626956 15:77211422-77211444 TCACCTCCATGGTATCTTAGTGG - Intronic
1129755863 15:78098578-78098600 TCACCTCCATGCTTTCCTCCTGG - Exonic
1130913149 15:88284625-88284647 TCACTCCCGTGGGGCCCTCGGGG - Intergenic
1132931153 16:2459910-2459932 TCACCTCCCTGGCGGCCTCGGGG + Intergenic
1133074051 16:3265790-3265812 TCACCTTCATGGTGTTCTCAGGG + Intronic
1135562349 16:23486536-23486558 TCACCACCTTGCTGCCCTTGAGG + Intronic
1140681869 16:77393128-77393150 TCACCTCCATGGTGACCAGATGG - Intronic
1142379241 16:89722144-89722166 TCCCCTGCTTCGTGCCCTCGCGG + Intronic
1143861402 17:9893477-9893499 TCACTCCCATAGTGCCCTCAAGG + Intergenic
1146289943 17:31599627-31599649 TAACCTCCTAGGTGCCCTCTGGG - Intergenic
1147185578 17:38711520-38711542 TTCTCTCCATGGTGCCCTCTTGG - Intronic
1147677727 17:42219322-42219344 GCACGTCCAGGCTGCCCTCGGGG + Exonic
1147688309 17:42300249-42300271 GCACGTCCAGGCTGCCCTCGGGG - Exonic
1147732071 17:42610154-42610176 ACTCCTCCACGATGCCCTCGGGG - Exonic
1148462686 17:47847403-47847425 CCTCCTCCTTGGCGCCCTCGTGG + Exonic
1149758863 17:59210858-59210880 TCAACTCAATGGAGCCCTCAAGG + Exonic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1155916729 18:31564841-31564863 GCATCTCCATGTTGCCCTCTGGG - Intergenic
1157254067 18:46122320-46122342 TCCCCTCCATGTTGCACTCTGGG - Intronic
1162127132 19:8505803-8505825 TCACCCCCACGGCGCCCCCGTGG - Intergenic
1165059728 19:33199221-33199243 TCACCTCCATGGAGCATTCCTGG + Intronic
1165138150 19:33683821-33683843 TCACCGCGATGGTGCTCTCAGGG + Intronic
1166248431 19:41547741-41547763 TGAGCTCCATAGTGCCCACGGGG + Intergenic
1166669527 19:44701528-44701550 TCCCCTCCCTGGGGTCCTCGGGG - Intronic
1167474083 19:49690205-49690227 TCTCCACCAAGGAGCCCTCGGGG + Exonic
1168385275 19:55958018-55958040 TCAACTCCATGTTGCACTGGAGG + Intronic
1202714332 1_KI270714v1_random:33907-33929 TCACCTCCAGGTGGCCCTCCTGG + Intergenic
926168758 2:10537616-10537638 TCCCCACCATGGTGCACTAGAGG + Intergenic
926312097 2:11682207-11682229 TCACCTCCAGGGGGCGCTCAAGG - Intronic
929188584 2:39120413-39120435 GCGCCTGCATGGTGCCCCCGGGG + Exonic
938680213 2:133681992-133682014 TCCCCTGCATGGTGACCTCTAGG - Intergenic
941746905 2:169096444-169096466 TCACCTCCATAGCTCCCTCTAGG - Intergenic
943052036 2:182925049-182925071 TAACTTCCATGGTGCCCTGTTGG - Exonic
946194657 2:218025866-218025888 CCACCTCCATGGTTCCCTGTTGG + Intergenic
946332766 2:219019511-219019533 TCACCTACAAGGTGCCCACCCGG - Exonic
947024647 2:225723361-225723383 ACACCTCCATGGTACCCTTCTGG - Intergenic
948081239 2:235207075-235207097 TCATCTCCATGGTGGCCCCAGGG - Intergenic
1170158034 20:13286266-13286288 GCACCTCTCTGGTGCCCTTGGGG + Intronic
1170996946 20:21370937-21370959 TCTCCCCCATGCTGCCCTTGTGG - Intronic
1171014256 20:21525493-21525515 TCACCTCCATGGTGCCTCTCTGG - Intergenic
1171349295 20:24490603-24490625 ACCCCTCCATGGTGTCGTCGGGG + Intronic
1171420199 20:25012756-25012778 ACACCTCCATGATGCCCCTGTGG - Intronic
1173580153 20:44141415-44141437 GCAGCTCCATGATGCCCTCAGGG - Intronic
1174767230 20:53265597-53265619 CCACCTCCCTGGCTCCCTCGGGG + Intronic
1174852487 20:54008299-54008321 TCCCCACCATGGTGTCCGCGGGG + Intronic
1175391058 20:58627818-58627840 TCACCACCATGATGCCCACATGG + Intergenic
1175972365 20:62693155-62693177 TCACCCCCAAGGTACCCTCAGGG + Intergenic
1176128362 20:63485986-63486008 TCCCCTCCTTGGAGGCCTCGTGG + Intergenic
1179923662 21:44521095-44521117 TCACCTCCCTGGTGTCCTTCTGG - Intronic
1180182909 21:46125813-46125835 TGGCCTCAAAGGTGCCCTCGTGG - Exonic
1181587128 22:23859167-23859189 TCACTTCCATGCGGCCCCCGTGG + Intronic
1183075576 22:35424531-35424553 TCACCTCCATCGTGCCCTCATGG + Exonic
1183281637 22:36935608-36935630 TCACCTCCGTGGTGTCTTCCAGG + Exonic
1184517508 22:44971704-44971726 CCACCTCCAGGGAGCCCTCGTGG + Intronic
1185284794 22:49995395-49995417 ACAGCTCCATGGGGCCCTCAGGG - Exonic
951558718 3:23945566-23945588 TCACCTCCATGGTGCCCTCGCGG - Exonic
952926875 3:38326680-38326702 TCTCCTCCATGGGGCCCACAGGG + Intergenic
953915100 3:46914030-46914052 TCACATCCCTGGTGGCCTCAGGG + Intergenic
954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG + Exonic
956071227 3:65454162-65454184 TTAGCTGCATGGTGCCCTGGGGG - Intronic
957746793 3:84354240-84354262 TAACTTGCATGGTGCCCTCCTGG - Intergenic
958667526 3:97160099-97160121 TAACCTCCATCCTGCCATCGTGG + Intronic
960949603 3:122990671-122990693 TCTCCTTCATGGAGCCCTCCTGG + Intronic
964397404 3:156259789-156259811 TGACCTCCATGATGCTCTGGAGG + Intronic
966430515 3:179827335-179827357 ACACCTCCATGGGGCCTTTGAGG - Intronic
968442303 4:630091-630113 TCTCCTCTCTGGTGCCCTCTGGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968722276 4:2216468-2216490 TCACCTCCAGGCTGCACACGAGG + Intronic
970202183 4:13621108-13621130 TCCCCTCCATGTTCCCCTCAGGG - Intronic
980626733 4:135382306-135382328 GCACTTCCATGTTGCCCTCAGGG + Intergenic
980680589 4:136155092-136155114 GCACCTCCATGGGGCCCACATGG - Intergenic
980798405 4:137714977-137714999 TGACCTCCAAGATGCCCTCGTGG + Intergenic
982831597 4:160068005-160068027 TCACCGCCATGGGGGCCTCAGGG + Intergenic
984883295 4:184429055-184429077 CCACCGGCATGGTGCCCTTGAGG + Exonic
986684800 5:10267302-10267324 TCTGCTCCATGGATCCCTCGGGG + Intergenic
991496955 5:67236359-67236381 TCACCTCCAGTGTGCCATCCTGG - Intergenic
994141083 5:96342114-96342136 CCACCACCATGATGCCCTCCAGG + Intergenic
995262575 5:110122708-110122730 TCACCCCCATGCTGCTCTCATGG + Intergenic
1002468897 5:179422941-179422963 GCATCTGCATGGTGTCCTCGGGG - Intergenic
1003645243 6:7909604-7909626 TCACCTCCCTGCTGCTCTCTCGG - Intronic
1003838827 6:10099260-10099282 TCACCTCCTTGGGTCCCTCAAGG + Intronic
1005317903 6:24621971-24621993 CTACCTCCATGGGGCCCTGGTGG + Intronic
1006146403 6:31962359-31962381 TCTCCCACATGGAGCCCTCGTGG - Intronic
1007492298 6:42232829-42232851 TCACCTGGTTGGTGCCCCCGTGG + Exonic
1007694287 6:43722240-43722262 TCACCTCCATGGAGCAGCCGAGG + Intergenic
1008236495 6:49057725-49057747 TCCCCTCCATACTGCCCTGGTGG + Intergenic
1016800460 6:148163666-148163688 TTACCTCCATGCTGTTCTCGTGG - Intergenic
1019556842 7:1636120-1636142 TCACCTCCAGGGTGACTTCCTGG - Intergenic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1027280873 7:76608708-76608730 CCACCCCCATGTTGCCCACGAGG + Intergenic
1030971818 7:116066774-116066796 TGAACTGAATGGTGCCCTCGTGG + Intronic
1033062526 7:138122330-138122352 GCAGCTCCATGGGGCCCTGGCGG + Intergenic
1036686517 8:10914995-10915017 TCACCTCAGTGGCGCCTTCGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1049270034 8:141690685-141690707 TCACCTCCTTTGTGCGCTCCTGG + Intergenic
1049735079 8:144200495-144200517 CCACCTGCAGGGTGCCCACGCGG - Exonic
1049920028 9:354617-354639 TCACCTCAAGGGTCCCCTGGGGG + Intronic
1052362643 9:27576755-27576777 TGACCTCCAAGGTGCCCACTTGG - Intergenic
1052374116 9:27698488-27698510 TCACTTACATGGTGGCCTTGTGG + Intergenic
1053052881 9:34976453-34976475 TCACCTCCAGGGCACCCTCGGGG - Intronic
1056569022 9:87799639-87799661 TCATCTCCATGCTGCCTTCCTGG - Intergenic
1057868736 9:98702095-98702117 TCACCTGCTTGGTGACCTTGGGG - Intronic
1059236848 9:112768166-112768188 TTACCTCCCTGGTGCCCTCCTGG + Intronic
1059915733 9:119097767-119097789 GCACACCCTTGGTGCCCTCGTGG + Intergenic
1061864793 9:133486521-133486543 TCTGCTGCATGGTGCCCTCTGGG + Intergenic
1062249881 9:135588697-135588719 TGATCTCCAGGTTGCCCTCGGGG - Intergenic
1062328000 9:136021951-136021973 ACCCCTCCATGCTGCCCTTGAGG - Intronic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic
1194980794 X:100438286-100438308 TGACCTCCAAGGTGCCCACTTGG + Intergenic