ID: 951558810

View in Genome Browser
Species Human (GRCh38)
Location 3:23945843-23945865
Sequence GCGCACGTGGCTCGCGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951558810_951558815 4 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558815 3:23945870-23945892 TGTTTACGTTCGGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 8
951558810_951558821 23 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558821 3:23945889-23945911 GCGGGCGCCGGTTGGCTGGGCGG 0: 1
1: 0
2: 2
3: 16
4: 149
951558810_951558822 24 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558822 3:23945890-23945912 CGGGCGCCGGTTGGCTGGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 181
951558810_951558816 5 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558816 3:23945871-23945893 GTTTACGTTCGGCGGCGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 8
951558810_951558819 19 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558819 3:23945885-23945907 GCGCGCGGGCGCCGGTTGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 159
951558810_951558813 -6 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558813 3:23945860-23945882 GTGCGCGCTGTGTTTACGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 10
951558810_951558820 20 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558820 3:23945886-23945908 CGCGCGGGCGCCGGTTGGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 85
951558810_951558818 15 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558818 3:23945881-23945903 GGCGGCGCGCGGGCGCCGGTTGG 0: 1
1: 0
2: 1
3: 42
4: 367
951558810_951558814 -3 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558814 3:23945863-23945885 CGCGCTGTGTTTACGTTCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 8
951558810_951558817 11 Left 951558810 3:23945843-23945865 CCGGCCGCGCGAGCCACGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 951558817 3:23945877-23945899 GTTCGGCGGCGCGCGGGCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951558810 Original CRISPR GCGCACGTGGCTCGCGCGGC CGG (reversed) Intronic