ID: 951566114

View in Genome Browser
Species Human (GRCh38)
Location 3:24013946-24013968
Sequence CCCTCCCAGAAACAAGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951566114_951566118 11 Left 951566114 3:24013946-24013968 CCTTAGTCTTGTTTCTGGGAGGG No data
Right 951566118 3:24013980-24014002 ATCCATGTAGCAGTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951566114 Original CRISPR CCCTCCCAGAAACAAGACTA AGG (reversed) Intergenic
No off target data available for this crispr