ID: 951566472

View in Genome Browser
Species Human (GRCh38)
Location 3:24017039-24017061
Sequence TTCTTGAAGGGGAATTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951566472_951566480 4 Left 951566472 3:24017039-24017061 CCTCCCAAATTCCCCTTCAAGAA No data
Right 951566480 3:24017066-24017088 CCTGCCGCTCCAGTTTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951566472 Original CRISPR TTCTTGAAGGGGAATTTGGG AGG (reversed) Intergenic
No off target data available for this crispr