ID: 951567946

View in Genome Browser
Species Human (GRCh38)
Location 3:24030753-24030775
Sequence GCTGACTCCACTTGTCCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951567946_951567952 16 Left 951567946 3:24030753-24030775 CCTTATGGACAAGTGGAGTCAGC No data
Right 951567952 3:24030792-24030814 TAGGTGTGCAGCCGTGTTTATGG No data
951567946_951567950 -3 Left 951567946 3:24030753-24030775 CCTTATGGACAAGTGGAGTCAGC No data
Right 951567950 3:24030773-24030795 AGCCTGGGTGCAGGAGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951567946 Original CRISPR GCTGACTCCACTTGTCCATA AGG (reversed) Intergenic
No off target data available for this crispr