ID: 951567951

View in Genome Browser
Species Human (GRCh38)
Location 3:24030775-24030797
Sequence CACCTAAGACTCCTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951567951_951567952 -6 Left 951567951 3:24030775-24030797 CCTGGGTGCAGGAGTCTTAGGTG No data
Right 951567952 3:24030792-24030814 TAGGTGTGCAGCCGTGTTTATGG No data
951567951_951567954 13 Left 951567951 3:24030775-24030797 CCTGGGTGCAGGAGTCTTAGGTG No data
Right 951567954 3:24030811-24030833 ATGGATGAAGATCTGTCTGCAGG No data
951567951_951567955 21 Left 951567951 3:24030775-24030797 CCTGGGTGCAGGAGTCTTAGGTG No data
Right 951567955 3:24030819-24030841 AGATCTGTCTGCAGGTGTCTAGG No data
951567951_951567956 28 Left 951567951 3:24030775-24030797 CCTGGGTGCAGGAGTCTTAGGTG No data
Right 951567956 3:24030826-24030848 TCTGCAGGTGTCTAGGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951567951 Original CRISPR CACCTAAGACTCCTGCACCC AGG (reversed) Intergenic
No off target data available for this crispr