ID: 951567954

View in Genome Browser
Species Human (GRCh38)
Location 3:24030811-24030833
Sequence ATGGATGAAGATCTGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951567951_951567954 13 Left 951567951 3:24030775-24030797 CCTGGGTGCAGGAGTCTTAGGTG No data
Right 951567954 3:24030811-24030833 ATGGATGAAGATCTGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951567954 Original CRISPR ATGGATGAAGATCTGTCTGC AGG Intergenic
No off target data available for this crispr