ID: 951567956

View in Genome Browser
Species Human (GRCh38)
Location 3:24030826-24030848
Sequence TCTGCAGGTGTCTAGGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951567951_951567956 28 Left 951567951 3:24030775-24030797 CCTGGGTGCAGGAGTCTTAGGTG No data
Right 951567956 3:24030826-24030848 TCTGCAGGTGTCTAGGTAAGAGG No data
951567953_951567956 0 Left 951567953 3:24030803-24030825 CCGTGTTTATGGATGAAGATCTG No data
Right 951567956 3:24030826-24030848 TCTGCAGGTGTCTAGGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951567956 Original CRISPR TCTGCAGGTGTCTAGGTAAG AGG Intergenic
No off target data available for this crispr