ID: 951570754 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:24060237-24060259 |
Sequence | CTGACCAAGGCGAATGTGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
951570754_951570757 | -5 | Left | 951570754 | 3:24060237-24060259 | CCAACCACATTCGCCTTGGTCAG | No data | ||
Right | 951570757 | 3:24060255-24060277 | GTCAGTCAGACTGAGTTGAAAGG | No data | ||||
951570754_951570758 | 21 | Left | 951570754 | 3:24060237-24060259 | CCAACCACATTCGCCTTGGTCAG | No data | ||
Right | 951570758 | 3:24060281-24060303 | TCCAACAGCTCTCCCCCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
951570754 | Original CRISPR | CTGACCAAGGCGAATGTGGT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |