ID: 951570754

View in Genome Browser
Species Human (GRCh38)
Location 3:24060237-24060259
Sequence CTGACCAAGGCGAATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951570754_951570757 -5 Left 951570754 3:24060237-24060259 CCAACCACATTCGCCTTGGTCAG No data
Right 951570757 3:24060255-24060277 GTCAGTCAGACTGAGTTGAAAGG No data
951570754_951570758 21 Left 951570754 3:24060237-24060259 CCAACCACATTCGCCTTGGTCAG No data
Right 951570758 3:24060281-24060303 TCCAACAGCTCTCCCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951570754 Original CRISPR CTGACCAAGGCGAATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr