ID: 951575955

View in Genome Browser
Species Human (GRCh38)
Location 3:24114335-24114357
Sequence CAAACACCTAGCGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951575951_951575955 11 Left 951575951 3:24114301-24114323 CCAACAAGATAGTGAAGAACTCT No data
Right 951575955 3:24114335-24114357 CAAACACCTAGCGCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951575955 Original CRISPR CAAACACCTAGCGCATCCTT TGG Intergenic
No off target data available for this crispr