ID: 951577824

View in Genome Browser
Species Human (GRCh38)
Location 3:24131689-24131711
Sequence CCTTGTCCTGTCCATCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951577816_951577824 26 Left 951577816 3:24131640-24131662 CCCTAATGAATGGGATTTGTGCC 0: 2
1: 33
2: 607
3: 1383
4: 2178
Right 951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG 0: 1
1: 0
2: 0
3: 9
4: 190
951577818_951577824 5 Left 951577818 3:24131661-24131683 CCCTTGTAAAAGACATCCCAAAG 0: 1
1: 1
2: 8
3: 103
4: 544
Right 951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG 0: 1
1: 0
2: 0
3: 9
4: 190
951577817_951577824 25 Left 951577817 3:24131641-24131663 CCTAATGAATGGGATTTGTGCCC 0: 2
1: 26
2: 527
3: 1361
4: 2178
Right 951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG 0: 1
1: 0
2: 0
3: 9
4: 190
951577819_951577824 4 Left 951577819 3:24131662-24131684 CCTTGTAAAAGACATCCCAAAGA 0: 1
1: 0
2: 11
3: 118
4: 578
Right 951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG 0: 1
1: 0
2: 0
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951577824 Original CRISPR CCTTGTCCTGTCCATCATGA AGG Intronic
900015533 1:146479-146501 CCTTGCCCTGTCACTCAGGATGG - Intergenic
900045797 1:505073-505095 CCTTGCCCTGTCACTCAGGATGG - Intergenic
900067998 1:746788-746810 CCTTGCCCTGTCACTCAGGATGG - Intergenic
902542620 1:17165544-17165566 CCTTGATCTGCCCAGCATGATGG + Intergenic
904954330 1:34270402-34270424 ACTTCTCCTGTCAATCATGATGG + Intergenic
905344629 1:37302820-37302842 CCTTCTCCCAACCATCATGAGGG + Intergenic
908054106 1:60264477-60264499 CCTTGTCCTTTCAGGCATGAGGG + Intergenic
908708878 1:66992654-66992676 CCTTGTCCAGTCAATCCCGATGG + Intergenic
910167974 1:84348095-84348117 CCTGGTCCTGTCGAGAATGATGG + Intronic
910420192 1:87052557-87052579 ACTTGTGCTTTCCATAATGATGG + Intronic
911674925 1:100647788-100647810 CCTGGTCCTGTTCCTCCTGATGG + Intergenic
912460583 1:109828321-109828343 CCATGTCCTGTTCCTCATGGAGG - Intergenic
912791500 1:112656478-112656500 ACTTGTCCAGTCCACCATAATGG - Intronic
915303812 1:154966513-154966535 CACTGTCCTGTCCCTCAGGATGG - Exonic
916253945 1:162766997-162767019 TCTTGTTCTGTCCCTCAGGATGG - Intronic
917825133 1:178812019-178812041 CCCTTCCCTCTCCATCATGAAGG + Intronic
920343992 1:205294194-205294216 CTTTGTTGTGTCCATCAGGAGGG - Intergenic
921986025 1:221313267-221313289 CTTTGTCCAGTCTACCATGATGG + Intergenic
922103362 1:222492167-222492189 CCTTGCCCTGTCACTCAGGATGG - Intergenic
922263683 1:223964679-223964701 CCTTGCCCTGTCACTCAGGATGG - Intergenic
924000497 1:239545716-239545738 CTTGGTTCTGTACATCATGATGG - Intronic
924345525 1:243069674-243069696 CCTTGCCCTGTCACTCAGGATGG - Intergenic
1062895950 10:1103471-1103493 CCTAGTGGTGACCATCATGATGG + Intronic
1066565157 10:36714454-36714476 CCTTATCCGGTCCACCTTGATGG - Intergenic
1066730816 10:38435138-38435160 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1068540962 10:58294567-58294589 CCTTGCCCTTTCCACCAAGATGG + Intergenic
1068785826 10:60972294-60972316 CTTTATCCAGTCTATCATGATGG - Intronic
1071180319 10:82976650-82976672 CCTTGCCCTGTACACCAAGAGGG + Intronic
1071501009 10:86204405-86204427 GCTTGTCCTGACTCTCATGAGGG - Intronic
1071512482 10:86271195-86271217 CAATGTCCTGTGAATCATGAGGG - Intronic
1073027795 10:100500879-100500901 CCAAGAGCTGTCCATCATGATGG - Intronic
1076972124 11:141546-141568 CCTTGCCCTGTCACTCAGGATGG - Intergenic
1079341647 11:19616623-19616645 CCCTGTCCTCCCCATCATCAGGG - Intronic
1081385321 11:42465315-42465337 TGTTGTCCTGCCCATCATGGAGG - Intergenic
1082762532 11:57141655-57141677 CCATGCCCTGTCCATCACCAAGG - Intergenic
1086518330 11:87640645-87640667 CCATGTCCTTTCCACCATGGTGG + Intergenic
1089321076 11:117627194-117627216 CGTTGTCCTGCCCATCAGAACGG + Intronic
1091155319 11:133366575-133366597 CCTTCTTCTCCCCATCATGAAGG - Intronic
1092064107 12:5575259-5575281 CCTTGTCCTCACCATCAAGGGGG - Intronic
1092149030 12:6234263-6234285 CCTTGTCATGTTCAGCAGGAAGG + Intronic
1092682977 12:11008408-11008430 CCTTGTCTTGCCCTACATGATGG - Intronic
1099438490 12:82671104-82671126 CCTTGCCCCTTCCATCATGTGGG + Intergenic
1103729987 12:123021110-123021132 CCTTTTCCTGCCCACCATGGTGG + Intronic
1104816784 12:131650964-131650986 CCTTGTTCTGTGCATTATCAAGG - Intergenic
1106477389 13:30110353-30110375 AGTTGTCCTGTCCATCCTCAAGG - Intergenic
1107163855 13:37263235-37263257 CCTTCCCCTGTCCTGCATGAAGG - Intergenic
1110020486 13:70463160-70463182 CTTTATCCAGTCTATCATGATGG - Intergenic
1113825119 13:113246699-113246721 CCTTTTCTTATCCATCATGAGGG + Intronic
1113974408 13:114215723-114215745 CCATGTCCTCACCAACATGAAGG + Intergenic
1114627862 14:24141124-24141146 CCTGGCCCTGTCCGTCATGTTGG - Exonic
1114829995 14:26128953-26128975 CCTTTTCCTGTCTACCAGGAAGG - Intergenic
1116658725 14:47681076-47681098 CCTTGTCCTGACAATGAGGAAGG + Intergenic
1119415576 14:74467301-74467323 CCCTGTCCTCTCCAGCATAAGGG + Intergenic
1121003320 14:90468072-90468094 CTTTATCCAGTCTATCATGATGG + Intergenic
1122311883 14:100802634-100802656 CCCTGTCCTGACCATGGTGATGG + Intergenic
1122968963 14:105144733-105144755 CCTGGGCCTGGCCAGCATGAGGG - Intronic
1123043608 14:105500565-105500587 CCTAGTGCTGCCCGTCATGATGG + Intergenic
1123939862 15:25211588-25211610 CCTCCTCCTGTCCATCCAGATGG + Intergenic
1126970451 15:54105264-54105286 CCATGTCCTGTTCACCATCACGG - Intronic
1127846830 15:62877672-62877694 CCTTGTCCTCGCCTCCATGAAGG - Intergenic
1129348718 15:74941084-74941106 CCTTTTCCTCACCATCATAAGGG - Intergenic
1131389986 15:92039822-92039844 CTTTATCCAGTCTATCATGATGG - Intronic
1135194078 16:20380181-20380203 CCTTGGCTTGTCCCTCCTGATGG + Intronic
1138884908 16:61064875-61064897 CTTTATCCAGTCCATCATTATGG - Intergenic
1140579934 16:76218147-76218169 CCTGTTCCTGCCCATCATAAAGG - Intergenic
1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG + Intronic
1140856808 16:78985214-78985236 CCATTTCCTGTTGATCATGAGGG + Intronic
1142299108 16:89246434-89246456 CTTTATCCAGTCTATCATGATGG - Intergenic
1142448124 16:90155976-90155998 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1142562061 17:816048-816070 CCGTGTCCTGCCCCTCCTGATGG - Intronic
1143125026 17:4636506-4636528 ACCTGTCCTCTCCATCCTGATGG + Intronic
1143698679 17:8640543-8640565 CATTATCCTTTCCATCCTGATGG + Intergenic
1144214458 17:13043106-13043128 CCTTTTGCCTTCCATCATGATGG - Intergenic
1149935841 17:60805886-60805908 CCTTGCTCTGTCCCTCAGGATGG + Intronic
1152125778 17:78445662-78445684 CCAGGTCCTGTCCATGAAGAAGG - Exonic
1152536207 17:80951564-80951586 CCATGTCCTGTGCAACCTGAGGG - Intronic
1157078943 18:44500404-44500426 CCTTGTCGTATCTATCATAATGG - Intergenic
1160649080 19:211855-211877 CCTTGCCCTGTCACTCAGGATGG - Intergenic
1163099674 19:15087197-15087219 CATTATCCTGGCCATCATCACGG + Exonic
1163780579 19:19245155-19245177 CACTGTCCTGCCCATCCTGACGG - Intronic
1166735477 19:45081583-45081605 CCTTATCCTGTCCATCACCGAGG + Intronic
1166749128 19:45156387-45156409 CACCGTCCTGTCCATCATGCTGG + Intronic
1167961716 19:53111199-53111221 TCTTGCCCTTTCCATCATGTGGG + Intronic
928409011 2:31039636-31039658 CCTAGTCCTGTCATTTATGAAGG + Intronic
931880896 2:66569677-66569699 CCTTTGTCTGTCCATCATAATGG + Intronic
932010666 2:67974455-67974477 CCTAGTCCTGGCCATGAGGAAGG - Intergenic
932365416 2:71149443-71149465 CCTTGTCCTTACCTTTATGAAGG - Exonic
934477578 2:94603569-94603591 TCTTGTCCTGTCTATCTGGAGGG - Intronic
935540350 2:104340843-104340865 CCGTGTCCTGTCCAGGATGGTGG - Intergenic
935924393 2:108051771-108051793 CCTTGTCATTTCCATCATTATGG + Intergenic
940220982 2:151351228-151351250 ACTTTTCCTTTCCATCATGTAGG - Intergenic
941746455 2:169091990-169092012 CTTTGTCCTGAACAGCATGAAGG + Intronic
943012944 2:182473872-182473894 CTTTATCCTGTCTATCACGATGG + Intronic
946297857 2:218799973-218799995 CCTAGTCCTGTTCATCTTGACGG + Intronic
946525065 2:220509389-220509411 CCTTTTCCTGTGCTTCATTACGG + Intergenic
947750470 2:232529426-232529448 ACTTGCCCTGTCCATCAGAAGGG + Intronic
947856693 2:233328902-233328924 CCTTGTCCTGTCCACCTCCATGG + Intronic
949059148 2:241946767-241946789 TATTGTCCTGTCGATGATGACGG - Intergenic
1168819575 20:763877-763899 CCTCCTCCTATCCATCATGATGG - Exonic
1170333879 20:15247222-15247244 CCTTGTCCTGTTTATCCTGGAGG + Intronic
1173425483 20:42939453-42939475 CCTTTTCCTTTCCTTCTTGAGGG + Intronic
1177815779 21:25974916-25974938 CCCTGTCCATTCCATCTTGAAGG - Intronic
1178718335 21:34986988-34987010 CCCTGGCCTGTCAATCATGTCGG - Intronic
1179589222 21:42395039-42395061 AATTGTCCTGTCAATCCTGAAGG - Intronic
1181982470 22:26775081-26775103 CCTTGTCTTCTCCATCATTTAGG + Intergenic
1182109143 22:27710613-27710635 CCCTGTCATGTCCATCTGGAGGG + Intergenic
1184018012 22:41800467-41800489 CCTCGTCCTGTCCCTCCTGCGGG - Intergenic
949774639 3:7619032-7619054 CCTTGTCCTCTCTAGCATGATGG - Intronic
950674367 3:14545595-14545617 CCATGTCCTGTCCTCCAGGAGGG - Intergenic
950938200 3:16865221-16865243 CCTTGACCTTTTCATGATGATGG - Intronic
951525323 3:23647684-23647706 CATTGTCCTGGCCATCACAATGG + Intergenic
951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG + Intronic
953679490 3:45028868-45028890 CCTTGTCCTGGCCCTCAGGGTGG + Intronic
954146511 3:48636912-48636934 CCCTGACCTGGCCATCTTGAGGG - Exonic
954418741 3:50407409-50407431 CCTGTTCCTGGCGATCATGAGGG + Intronic
955732692 3:62004034-62004056 CCTTCTTCTGTCCAGCAGGATGG - Intronic
955822479 3:62910590-62910612 CCTTGACATCTCCATCATGAAGG - Intergenic
958630416 3:96675428-96675450 GCTAGTCCTGTCCCTCATCATGG + Intergenic
958764986 3:98357127-98357149 CCTGGTCTTCTCCATTATGATGG + Intergenic
959582659 3:107997755-107997777 CCTCTTCCTGTCCATCATCAGGG + Intergenic
963062954 3:141240141-141240163 TCTTGGCCTTTCCTTCATGATGG + Intronic
967012499 3:185449639-185449661 TCTTGTCCAGTCCATTATGCTGG + Intronic
968349985 3:198046064-198046086 CCTTGTCCAGCCCATCCTGCTGG + Intergenic
968368767 3:198208272-198208294 CCTTGCCCTGTCACTCAGGATGG + Intergenic
968794896 4:2696832-2696854 TCTTGTGCTGGCCATCATGAGGG + Intronic
969625376 4:8302279-8302301 CCCTCTCCTGACCATCATCATGG - Intronic
975202816 4:71611092-71611114 CCATGTCCTGCCCACCTTGAGGG + Intergenic
975241454 4:72064677-72064699 CCTAGTACTGTCACTCATGATGG - Intronic
979257190 4:118618004-118618026 CCTTGCCCTGTCACTCAGGATGG + Intergenic
979331160 4:119422544-119422566 CCTTGCCCTGTCACTCAGGATGG - Intergenic
984787207 4:183578832-183578854 TCTTGTTCTGTCTGTCATGAAGG + Intergenic
985528581 5:420662-420684 CCTTGTGGTGTCCACCAGGAGGG + Intronic
986264599 5:6181209-6181231 CCTTCTCCCCTCCATCCTGAGGG + Intergenic
989471197 5:41820759-41820781 CCTAGACCTGTCAATCAAGATGG + Intronic
993534540 5:89066417-89066439 TCTAGTCCTGACCATCAAGAGGG + Intergenic
999943046 5:156565415-156565437 CATAGACCTGTCCATCATTATGG + Intronic
1000872471 5:166593809-166593831 CCATGTGATTTCCATCATGAAGG - Intergenic
1002728044 5:181313837-181313859 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1004600465 6:17145077-17145099 CCTAGCCCTGCCCAACATGATGG - Intergenic
1006141898 6:31934283-31934305 CCTGACCCTGTCCACCATGAGGG - Exonic
1007814777 6:44513925-44513947 CCTTATCCACTCCCTCATGATGG - Intergenic
1013444830 6:110213966-110213988 CTTTGTCCGGACCATGATGATGG + Intronic
1015029250 6:128574540-128574562 CCTTGTCCTGGCTATTATTATGG + Intergenic
1015169263 6:130233025-130233047 CATTGTGCTGTCCTTCCTGAAGG - Intronic
1018595174 6:165471569-165471591 CCCTGACCTGTCCATCCTGCAGG + Intronic
1020029159 7:4920745-4920767 CCTTGTCTTGTCCCCCATGCTGG + Intronic
1020141177 7:5612777-5612799 CCTTGTCCTCCCCATCAGAAGGG + Intergenic
1020682691 7:11256572-11256594 CTTTCTCCTGTGCATCTTGACGG + Intergenic
1021401400 7:20213532-20213554 CTTTATCCAGTCCATCATTATGG - Intronic
1021865014 7:24947114-24947136 CCTTGACTTGACCATCATCAAGG - Intronic
1023399163 7:39779279-39779301 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1023793436 7:43771686-43771708 ACTTGTCCTGTCCATCCACATGG + Intronic
1024651279 7:51405426-51405448 CCTTGCCCTGTCACTCAGGATGG - Intergenic
1025055413 7:55761007-55761029 CCTTGCCCTGTCACTCAGGATGG - Intergenic
1025133484 7:56391236-56391258 CCTTGCCCTGTCACTCAGGATGG - Intergenic
1026603075 7:71792758-71792780 CCTTTTCCATTCCATCTTGAGGG + Intronic
1026743648 7:72994693-72994715 CCTTCTCCTGACAATTATGATGG + Intergenic
1026783731 7:73286165-73286187 CCTTCTCCTGACAATTATGATGG + Intergenic
1026803562 7:73415358-73415380 CCTTCTCCTGACAATTATGATGG + Intergenic
1027029754 7:74879391-74879413 CCTTCTCCTGACAATTATGATGG + Intergenic
1027100087 7:75370384-75370406 CCTTCTCCTGACAATTATGATGG - Intergenic
1027795809 7:82691709-82691731 ACCTTTCCTCTCCATCATGAGGG - Intergenic
1029407453 7:100384174-100384196 CCTTGGCCTGAGCATCTTGAAGG + Intronic
1032002824 7:128276326-128276348 CCTGGGCCTGGCCATCATGGTGG + Intergenic
1032049496 7:128638782-128638804 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1032387519 7:131534654-131534676 CCTTCCCTTGTCCATCACGATGG + Intronic
1033590263 7:142802860-142802882 CTTTCTCCTGTTCATCCTGATGG + Intergenic
1034130767 7:148714913-148714935 TCTTGCCCTGTCCCTCAGGATGG + Intronic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035064308 7:156094220-156094242 GCCTGTCCTGTCCATCAGAATGG - Intergenic
1035521806 8:280614-280636 TCTTATGCTGTTCATCATGATGG - Intergenic
1036662900 8:10719355-10719377 CCTTCTCCTGTGCTTCCTGACGG - Intergenic
1037828579 8:22174984-22175006 AGTTGTCCTGTCCAGCTTGAGGG + Intronic
1038403654 8:27305715-27305737 CCTTGTCTTATCCATCTTGCAGG - Intronic
1038895217 8:31775202-31775224 CCTTATCCAGTCCTCCATGATGG - Intronic
1041196288 8:55404824-55404846 CATTCACCTGTCCATCATGGTGG + Intronic
1044033519 8:87268336-87268358 CTTTATCCAGTCCACCATGATGG + Intronic
1045620600 8:103973347-103973369 CCTTGTGCTGTGCATAATCATGG + Intronic
1049303352 8:141883578-141883600 CCCTGTCCTCTCCAGGATGAGGG + Intergenic
1050010194 9:1178265-1178287 CCTCATCCAGTCTATCATGATGG - Intergenic
1052852389 9:33385987-33386009 TCTTGTCCTGTCTATCCGGAGGG + Intronic
1053526300 9:38833780-38833802 TCTTGTCCTGTCCCTCAGGCTGG - Intergenic
1053680488 9:40482538-40482560 TCTTGTCCTGTCTATCCGGAGGG + Intergenic
1053930477 9:43110849-43110871 TCTTGTCCTGTCTATCCGGAGGG + Intergenic
1054198526 9:62058204-62058226 TCTTGTCCTGTCCCTCAGGCTGG - Intergenic
1054283224 9:63142397-63142419 TCTTGTCCTGTCTATCCGGAGGG - Intergenic
1054293573 9:63318053-63318075 TCTTGTCCTGTCTATCCGGAGGG + Intergenic
1054391595 9:64622542-64622564 TCTTGTCCTGTCTATCCGGAGGG + Intergenic
1054504133 9:65893786-65893808 TCTTGTCCTGTCTATCCGGAGGG - Intronic
1054639827 9:67530157-67530179 TCTTGTCCTGTCCCTCAGGCTGG + Intergenic
1057218954 9:93245398-93245420 CCATGTCCTGTCCCTCGGGACGG + Intronic
1057713204 9:97465903-97465925 CAGTGTCCTTCCCATCATGAAGG - Intronic
1060030475 9:120210701-120210723 CCTTGTGCTGTCCATTAACAGGG - Intergenic
1061546526 9:131307924-131307946 CCTGCTCCTGGACATCATGACGG + Exonic
1062753108 9:138270978-138271000 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1203575623 Un_KI270745v1:5755-5777 CCTTGCCCTGTCACTCAGGATGG + Intergenic
1185845324 X:3432503-3432525 CCTTGTCCCTTCCACCATGTGGG - Intergenic
1186894611 X:13993316-13993338 CTATATCCTGTGCATCATGATGG - Intergenic
1189853472 X:45199753-45199775 CCTTGTCCTGACCTCCAGGAAGG + Intronic
1201951663 Y:19571852-19571874 CCTTGTTGTGTGCATCCTGATGG + Intergenic