ID: 951584377

View in Genome Browser
Species Human (GRCh38)
Location 3:24200369-24200391
Sequence TAGGACTAGGGTATGATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951584372_951584377 25 Left 951584372 3:24200321-24200343 CCTTTTCAGGGTAGAAAATACAC 0: 1
1: 1
2: 2
3: 22
4: 190
Right 951584377 3:24200369-24200391 TAGGACTAGGGTATGATTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 127
951584370_951584377 27 Left 951584370 3:24200319-24200341 CCCCTTTTCAGGGTAGAAAATAC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 951584377 3:24200369-24200391 TAGGACTAGGGTATGATTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 127
951584371_951584377 26 Left 951584371 3:24200320-24200342 CCCTTTTCAGGGTAGAAAATACA 0: 1
1: 1
2: 2
3: 43
4: 429
Right 951584377 3:24200369-24200391 TAGGACTAGGGTATGATTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951584377 Original CRISPR TAGGACTAGGGTATGATTTG TGG Intronic
900720139 1:4170593-4170615 CAGGAGAAGGGTTTGATTTGGGG + Intergenic
900769437 1:4528929-4528951 TGGGACTAGGGGTTGATTTGGGG - Intergenic
902803194 1:18843974-18843996 GAGGTCTTAGGTATGATTTGAGG - Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
906453598 1:45974221-45974243 TAGGAATAGGGGAGGATGTGGGG + Intronic
909281675 1:73763196-73763218 TTTGACTAGGGTATTATTAGAGG - Intergenic
910326155 1:86009856-86009878 TGGGACTAGGGTTTTATATGAGG + Intronic
913227052 1:116709649-116709671 TAGCATCAGGGGATGATTTGGGG - Intergenic
915977114 1:160398857-160398879 TAGCACTGGGGTGTGCTTTGGGG + Intergenic
916801908 1:168223729-168223751 TAGGACATGGGTATCTTTTGGGG + Intergenic
922589321 1:226762431-226762453 TAGGACAAGGGAAGGATGTGAGG + Intergenic
922612847 1:226942718-226942740 GTGGACATGGGTATGATTTGTGG + Intronic
923024292 1:230192227-230192249 TAGGACCTGGGTTTGAGTTGTGG + Intronic
924619967 1:245651824-245651846 TGGGAGTAGGGAATGGTTTGGGG - Intronic
1063422646 10:5925623-5925645 TAGGACTAGGAGGTGTTTTGTGG - Intronic
1067022633 10:42814985-42815007 TAGGACTAGGGAATGCATAGTGG - Intronic
1068189443 10:53631589-53631611 TAGGCTTAGGGTTTGACTTGAGG - Intergenic
1069008554 10:63345844-63345866 TAGTACTTGAGTATGATTTCTGG - Intronic
1070391227 10:75972389-75972411 TATGAATAGGATAGGATTTGGGG - Intronic
1072062570 10:91829538-91829560 GAGGAGTAGGGTGTAATTTGAGG + Intronic
1072392067 10:94997576-94997598 TAGGCCTAGGGGATTATTAGGGG + Intergenic
1072417783 10:95263299-95263321 TAGGAATAGGTTCTGATCTGGGG - Intronic
1073057487 10:100711607-100711629 TAGGAGTAGGGTAGGAGTAGAGG - Intergenic
1073637672 10:105216208-105216230 GAGAACAAGGGTATAATTTGGGG + Intronic
1074497705 10:113994343-113994365 TAGAAATAGGGTAGAATTTGGGG + Intergenic
1076089755 10:127673012-127673034 TAGGTCTATGGTAAAATTTGAGG - Intergenic
1077553415 11:3214313-3214335 TAGGACCACGGGATGATTTGAGG + Intergenic
1080188404 11:29519349-29519371 CAGGACCATGGTAAGATTTGGGG + Intergenic
1086986986 11:93261510-93261532 TAGGCCTAGGGGATTATTAGGGG - Intergenic
1088403107 11:109442487-109442509 CAGGACTATGGTAGGACTTGAGG - Intergenic
1088429310 11:109741445-109741467 TAGTAGTAGGGTTTAATTTGTGG - Intergenic
1093137253 12:15467523-15467545 TAGGACTAGGGTGGTATTGGGGG - Intronic
1093523811 12:20082846-20082868 TGGGACTAGGGTTTGAATTGAGG + Intergenic
1097756811 12:63416029-63416051 TAGGCCTAGGGGATTATTAGGGG - Intergenic
1100775202 12:97965995-97966017 TAGGACCAGGCTCTGAGTTGGGG + Intergenic
1101033484 12:100682654-100682676 TAGGGTTAGGATATGATTTGTGG - Intergenic
1102202610 12:111068025-111068047 CTGGACTAGGGTATGATCGGTGG - Intronic
1104645595 12:130495171-130495193 TAGGACTTGGGCGTCATTTGGGG + Intronic
1105607549 13:21939223-21939245 TAGGATTATGGTATTATTTCTGG - Intergenic
1106780985 13:33058673-33058695 AAAGACTAGGGTATCATTTCTGG - Intronic
1110406359 13:75154799-75154821 TAGGACTATGCCATGGTTTGAGG - Intergenic
1113328591 13:109307512-109307534 TAGAACTAAGTTATGCTTTGAGG - Intergenic
1113380016 13:109795801-109795823 TAGCACTTGGTGATGATTTGGGG + Intergenic
1114887437 14:26871183-26871205 CAGAACAAGGGTATGATTTAGGG - Intergenic
1120897763 14:89549583-89549605 TTGGACTAGTATAAGATTTGGGG - Intronic
1124848376 15:33312359-33312381 TGGGACTTGGGTCTTATTTGGGG + Intronic
1125015676 15:34932091-34932113 TTGGACTAAATTATGATTTGGGG - Intronic
1127451912 15:59124707-59124729 TAGGAATAAGGTATCATTGGGGG + Intronic
1128422869 15:67511189-67511211 TAAAACTTGGGTTTGATTTGGGG - Intergenic
1128646145 15:69380207-69380229 ATGGACTGGGGTAAGATTTGAGG + Intronic
1129815909 15:78554043-78554065 TAGGACTGGGCAGTGATTTGGGG - Intergenic
1133860790 16:9593085-9593107 CAAGACTAGAGGATGATTTGTGG - Intergenic
1136861083 16:33703740-33703762 TAGGACTAGGGAATGCATAGTGG + Intergenic
1203122579 16_KI270728v1_random:1551930-1551952 TAGGACTAGGGAATGCATAGTGG + Intergenic
1152962254 18:86870-86892 GAGAACTAGGGTATGTTTGGGGG - Intergenic
1153711210 18:7801344-7801366 TAGGCCTAGGGTAAGATGTTTGG - Intronic
1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG + Intronic
1164995998 19:32720571-32720593 TGGGGCTAGGGTAGGAGTTGGGG - Intronic
1165190884 19:34062465-34062487 TGGGACTAGGGAAGGAGTTGAGG - Intergenic
929183682 2:39070545-39070567 CAGGACTAGGGATAGATTTGGGG - Intronic
931223414 2:60308640-60308662 GAGGACTTGGGTATGTTTTGAGG - Intergenic
931940387 2:67245741-67245763 TAGGACTTGGATATCTTTTGGGG - Intergenic
933216795 2:79639651-79639673 TATGACTTGGTTATAATTTGAGG + Intronic
934459453 2:94204884-94204906 TAGGACTAGGGAATGCATAGTGG + Intergenic
935318790 2:101864776-101864798 TAGGACCAGGGAAGGAGTTGGGG + Intronic
938804314 2:134791954-134791976 TTGGACAAGGGTAAGATTTTTGG + Intergenic
943290197 2:186061254-186061276 AAGCACTATGGTAAGATTTGGGG + Intergenic
943545140 2:189266643-189266665 TGGGAATAGGGTGTGTTTTGGGG + Intergenic
1172810570 20:37644883-37644905 TAGGAATAGGGTACTATTGGGGG - Intergenic
1173059283 20:39646224-39646246 TAGGACTTGGTAATGAATTGAGG - Intergenic
1178297659 21:31423888-31423910 GAGAAATAGGGAATGATTTGGGG + Intronic
1179906598 21:44426130-44426152 TAGGACCAGGGCATGACCTGGGG - Intronic
1179962607 21:44778101-44778123 TAGGATAAGGGTATGAATTACGG + Intronic
1181356749 22:22301586-22301608 TAGGACTAGGGAATGCATAGTGG - Intergenic
1184123061 22:42466174-42466196 TAGGAATAGCTTATGATTTGGGG - Intergenic
949316746 3:2764930-2764952 AAGGGCTAGGGTATGATTCCAGG + Intronic
949610455 3:5698603-5698625 TAGGCCTAGGGGATTATTAGGGG + Intergenic
949670633 3:6395866-6395888 TAGGAGTTGGATATGATTTTAGG + Intergenic
949949449 3:9217246-9217268 TAGGGCTGGGGTATAATTTAAGG - Intronic
951584377 3:24200369-24200391 TAGGACTAGGGTATGATTTGTGG + Intronic
953170590 3:40503301-40503323 TAGAACTAGGGTTAGATTTAAGG + Intergenic
955695028 3:61627297-61627319 TTGGAGTAAGGTGTGATTTGGGG + Intronic
957414790 3:79887497-79887519 TAGGACCAGTGTAAGATTGGTGG + Intergenic
957509174 3:81165813-81165835 TTGGACTAGGGTTGTATTTGTGG + Intergenic
958925094 3:100148994-100149016 CATGACTATGGTATGATTAGTGG - Intronic
961100189 3:124191912-124191934 GAGGACTAGGGAACAATTTGTGG + Intronic
965030393 3:163358041-163358063 TAGGACAAGAGAATGATTTGTGG - Intergenic
973828433 4:54733721-54733743 TAGGACAAGGGTTTGTTCTGAGG - Intronic
977584218 4:98758019-98758041 TAAGACTAGGGTTTTATTTTGGG - Intergenic
977595598 4:98875889-98875911 TAGGACTAGGGTTTTATTACTGG - Intronic
978138318 4:105289800-105289822 TAAGACTGGGGTATGAGTGGGGG - Intergenic
979092921 4:116509822-116509844 CAGGGCTAGGGTAGGAGTTGGGG - Intergenic
985471519 5:50145-50167 CAGGACTAGGGTTTGGTTTAGGG - Intergenic
986444778 5:7811742-7811764 GGAGACTAGGGTCTGATTTGGGG - Intronic
995956379 5:117781762-117781784 TAGGACAAATGAATGATTTGGGG + Intergenic
996826141 5:127683430-127683452 TAGGAGGAGGGTATCATTTGGGG + Intergenic
997024673 5:130044725-130044747 TAGGACTAGGGTATCATTATGGG + Intronic
999868178 5:155724536-155724558 TAGGTCTAGGATTTGATTTCAGG - Intergenic
1006450167 6:34101267-34101289 TAGGACTATGGTAAGATTGAAGG - Intronic
1008059595 6:46983574-46983596 TAGAACTAAGGGATGCTTTGTGG + Intergenic
1010055221 6:71556868-71556890 TAAGACTTTGGTGTGATTTGGGG + Intergenic
1011057092 6:83217144-83217166 TGGAACTAGGGAATGGTTTGGGG - Intronic
1013174776 6:107667860-107667882 TAGGACTAAGGCAGGAGTTGAGG + Intergenic
1019900665 7:4018292-4018314 TAGGTCTCAGGCATGATTTGGGG - Intronic
1022848958 7:34240340-34240362 TTGGACCAGGGTTTGTTTTGGGG - Intergenic
1024037820 7:45523726-45523748 TAGGATTTGGTTAGGATTTGTGG + Intergenic
1026096801 7:67352938-67352960 TAGGATTAGGATTTGATTTAGGG - Intergenic
1031491722 7:122397721-122397743 TAAGGATAGGTTATGATTTGGGG + Intronic
1031973663 7:128080776-128080798 TAGGCCTGGGGTAGGATCTGGGG + Intronic
1033462255 7:141557518-141557540 TACGACTAGGTGAAGATTTGAGG + Intronic
1045473588 8:102534903-102534925 GAGCACTGGGGTATGAGTTGGGG - Intronic
1050889932 9:10811813-10811835 TGGGATTTGGGTATGATTTAGGG - Intergenic
1059604022 9:115813442-115813464 TGGGTCTGGGGAATGATTTGGGG - Intergenic
1062252030 9:135603098-135603120 CAGGACTGGGTGATGATTTGGGG - Intergenic
1062645770 9:137547434-137547456 TAGGGCTAGGGTTAGGTTTGTGG - Intronic
1062735888 9:138137247-138137269 GAGAACTAGGGTATGTTTGGGGG + Intergenic
1187081975 X:15999804-15999826 TAGGACTGGGGTCTCATCTGAGG + Intergenic
1187530189 X:20089488-20089510 AAGGACTAGGGCATAAATTGAGG - Intronic
1187677668 X:21733971-21733993 AGGGGCTAAGGTATGATTTGGGG - Intronic
1188796801 X:34476936-34476958 TAGCTCTGGGGTATAATTTGAGG + Intergenic
1190172078 X:48119722-48119744 TATGAGAAGGGAATGATTTGGGG - Intergenic
1190177686 X:48165077-48165099 TATGAGAAGGGAATGATTTGGGG - Intergenic
1190180502 X:48187520-48187542 TATGAGAAGGGAATGATTTGGGG + Intronic
1190183692 X:48217052-48217074 TATGAGAAGGGAATGATTTGGGG - Intronic
1190193501 X:48296710-48296732 TATGAGAAGGGAATGATTTGGGG + Intergenic
1190204484 X:48392058-48392080 TATGAGAAGGGAATGATTTGGGG - Intronic
1190206052 X:48403345-48403367 TATGAGAAGGGAATGATTTGGGG + Intronic
1190378981 X:49819693-49819715 GAGGATTAGGCTATAATTTGAGG - Intergenic
1190472671 X:50798551-50798573 TAGGACAAGCATAGGATTTGGGG + Intronic
1193860228 X:86656180-86656202 TAGGAGTTGGGTAAGAATTGAGG + Intronic
1194309177 X:92282361-92282383 TTGAACTAGGGTATTATTTTTGG - Intronic
1194438177 X:93894844-93894866 TAGGACTAGCCTAAGAGTTGCGG + Intergenic
1196315427 X:114216702-114216724 AAGGTCTAGGGTACAATTTGTGG + Intergenic
1196639698 X:118044477-118044499 TAGCTCTAGAGTATAATTTGAGG - Intronic
1198588778 X:138152924-138152946 TAGAAGTTGGATATGATTTGGGG - Intergenic
1201754190 Y:17468758-17468780 TAGGAGTAGGTTATGCTTTAGGG + Intergenic
1201847362 Y:18437227-18437249 TAGGAGTAGGTTATGCTTTAGGG - Intergenic