ID: 951584446

View in Genome Browser
Species Human (GRCh38)
Location 3:24201144-24201166
Sequence GAAAATGAAGAGAAGCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 0, 2: 12, 3: 99, 4: 859}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951584446 Original CRISPR GAAAATGAAGAGAAGCAGGT AGG Intronic
901862293 1:12082033-12082055 GGAAAAGAAGGGAAGCAGGAAGG - Intronic
901865806 1:12106013-12106035 AAACATGAAGAGAAGAAGGCAGG - Intronic
902494595 1:16861460-16861482 GAAAATGAAGAAATAAAGGTTGG - Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
902934750 1:19757004-19757026 GAAAAAAAAGTGAAGGAGGTCGG + Intronic
903018290 1:20375994-20376016 GAAAAGGCAGAGAAGGAAGTGGG - Intergenic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903706997 1:25293194-25293216 GAAATGGAGGAGAAGCAGGAGGG + Intronic
903720241 1:25400153-25400175 GAAATGGAGGAGAAGCAGGAGGG - Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904358595 1:29958113-29958135 GAAAAAGAAAAGAAAAAGGTGGG + Intergenic
904498258 1:30899734-30899756 GGAATTGAAGAGAAGCAGGGAGG - Intronic
904701092 1:32358562-32358584 GAGAATGAAGTGACCCAGGTAGG + Intronic
905055556 1:35090607-35090629 GATAGTGAGGAGAAGCAGGCAGG + Intronic
905100674 1:35519201-35519223 GAAAATAAATCGAAACAGGTAGG + Intronic
905102409 1:35536205-35536227 GAAACTGAAGAAAAGCAGAGTGG + Intronic
905482241 1:38269516-38269538 GCAAGTGAAGAGAAGCAGACAGG - Intergenic
905654791 1:39679181-39679203 GAAAAGAAAGAGAAGAAGCTGGG - Exonic
906158859 1:43632132-43632154 TAAAACAAAGAAAAGCAGGTTGG + Intergenic
906414934 1:45614105-45614127 GAAAATGAGGAGGAGGAGATTGG + Exonic
906709474 1:47918578-47918600 GGAAAGGAAGAGAAGGAGGGAGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907087736 1:51692583-51692605 GAAAAGGAAGAAAAGGAGGGAGG - Intronic
907104661 1:51871563-51871585 GAAATTGAAAAGGAGCAGTTGGG - Intronic
907281616 1:53350721-53350743 GACAGTGAAAAGAAGCATGTAGG - Intergenic
907356567 1:53879874-53879896 GAGAATGAAGAAAAGCAGGGTGG + Intronic
907642216 1:56202280-56202302 GGAAAGGTAGAGAAGCAGGAAGG + Intergenic
908493724 1:64673001-64673023 AAAAATGAAGGGAAGCTGGCAGG - Intronic
908831136 1:68179641-68179663 GAAAATGCTGAGAAGCTGGAGGG + Intronic
908865728 1:68547364-68547386 GAAAATGAAGAAAAGCAGGGTGG + Intergenic
909130293 1:71727186-71727208 GAAACTGAAAGGAAGTAGGTAGG - Intronic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
909394731 1:75156859-75156881 GAAAAGCAACAGAAGTAGGTAGG - Intronic
909919227 1:81359766-81359788 GAAGACTAAGAGAAACAGGTTGG - Intronic
909992546 1:82240449-82240471 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
910262445 1:85305428-85305450 GCAAGTGAAGAGAAGCTGTTGGG - Intergenic
911204609 1:95079720-95079742 GAAAATGAAGACAGGAGGGTGGG + Intergenic
911339508 1:96619570-96619592 GAAAATGATTAGAAGAAGATAGG - Intergenic
911480912 1:98439355-98439377 AAAAGTGAAGAGAAGAAGGCAGG + Intergenic
911854244 1:102856602-102856624 GAAAATAAAGAAAAGGAGGGGGG - Intergenic
911995935 1:104766465-104766487 TAAAAAGAAGCCAAGCAGGTAGG - Intergenic
912190011 1:107327100-107327122 TAAGCTGAAGAGAAGCAGCTGGG + Intronic
913428409 1:118761034-118761056 GAAAAGGAGCAGAAGCAGGGTGG + Intergenic
914450849 1:147790154-147790176 TAAAATGAAGAAAAGCAGAGAGG + Intergenic
915288655 1:154868544-154868566 GAAAATGGAGTGGAGCAGGGAGG + Intronic
915613337 1:157013838-157013860 GAAAAGGAAGAGAAGCTGAGAGG - Intronic
915625171 1:157109964-157109986 GAAGATGAGAGGAAGCAGGTAGG - Intergenic
917065281 1:171086374-171086396 TAAAATGAAGGGCAGCTGGTTGG - Intergenic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
917422597 1:174880584-174880606 AAAAAGGAAGAGAGGCAGGGAGG - Intronic
917670349 1:177268024-177268046 AAACTTGAAGAGAAGAAGGTGGG - Intronic
918104944 1:181408738-181408760 GAATAAGAAGAGAAGTAGGTAGG + Intergenic
919345204 1:196366928-196366950 GAAAATTAAGTGGAGTAGGTTGG + Intronic
919843399 1:201625710-201625732 CAAAATGAAGGGAATCAGGTAGG - Intronic
920084912 1:203408433-203408455 GAGAAAGGAGAGAAGCAGATAGG + Intergenic
920771970 1:208894900-208894922 GAAGAGGAAGAGAAGGAGGGTGG - Intergenic
920779855 1:208978723-208978745 GAAAATGAAGTGAAGTAAGTGGG + Intergenic
921009787 1:211130137-211130159 GAATATAAAGAGAAACAGGCTGG + Intronic
921145079 1:212347280-212347302 GAAAACTAAGAGAAACAGGCAGG - Intronic
921249140 1:213280150-213280172 GATAATGAAGACAAGGAGGAAGG + Intergenic
922120017 1:222656498-222656520 GAAAATGACGAAAGGCAGCTAGG - Intronic
922502557 1:226108144-226108166 GAAAATGAAAATAAGAAGCTAGG - Intergenic
922710755 1:227829066-227829088 GAGAATGAAGAAAGGCAGGGTGG - Intronic
923275897 1:232396058-232396080 GAAAGTGGAGAGAAGTAGGTAGG - Intergenic
923419188 1:233795897-233795919 GAAAAGGCAGGGAAGCTGGTGGG + Intergenic
923587119 1:235283505-235283527 GAAAATCCAGAAAATCAGGTAGG - Intronic
923719574 1:236455398-236455420 GCATATCAAGAGAAGCAGGTAGG - Intronic
924016765 1:239734810-239734832 CAAGATGGAGAGAAGTAGGTGGG + Intronic
924033981 1:239917167-239917189 GATAATGATGAGAATCACGTTGG + Intergenic
924527579 1:244865411-244865433 GAATAGGAAGAGAATCAAGTGGG - Intergenic
924724731 1:246658908-246658930 AAGAAGGAAGAGGAGCAGGTGGG - Intronic
1062821385 10:536974-536996 GAAGATGAACAAAAGAAGGTGGG + Intronic
1062942290 10:1433130-1433152 GAAAATGAAGTGAAGAGAGTAGG + Intronic
1063227870 10:4033374-4033396 GATGCTGAAGAGAAGGAGGTGGG - Intergenic
1063235601 10:4112325-4112347 GAAAATGAGGATAAGAAGGGGGG + Intergenic
1064368902 10:14733828-14733850 GAAAATGTGGAGAAGCAGTGTGG - Intronic
1064382722 10:14860950-14860972 GAGAAGGAAGAGAACCAGGAAGG + Intronic
1065035102 10:21630055-21630077 AAGAAAGAAGAGAAGCATGTAGG + Intronic
1065060792 10:21898988-21899010 GAAAATGAAGAAAAGCGGGGTGG + Intronic
1065196363 10:23270223-23270245 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1065714740 10:28555153-28555175 GATACTGAAGAGTAGAAGGTTGG - Intronic
1065715402 10:28561967-28561989 GGTAAGGATGAGAAGCAGGTAGG + Intronic
1065994234 10:31041430-31041452 GGAAGCGAAGAGAAGCAGGGAGG - Intergenic
1066025551 10:31355769-31355791 GTAAATGTAGAGAAGAATGTAGG + Intronic
1066702994 10:38149508-38149530 CAAAATGAAGAAAAGCGGATAGG - Intergenic
1067203132 10:44192239-44192261 AAAAATGAAGAGGAGAAGGATGG + Intergenic
1067342276 10:45415743-45415765 GCAAAAGAAAAGGAGCAGGTAGG + Intronic
1067449890 10:46375800-46375822 GGAGATGAAGAGACACAGGTTGG - Exonic
1067587360 10:47483963-47483985 GGAGATGAAGAGACACAGGTTGG + Exonic
1067634415 10:47991730-47991752 GGAGATGAAGAGACACAGGTTGG + Intergenic
1067719769 10:48719610-48719632 GTAAATGAGGAGAAACAGGAGGG + Intronic
1068321731 10:55426920-55426942 CATAGAGAAGAGAAGCAGGTGGG - Intronic
1068818022 10:61339935-61339957 CAAAATGCAGAGAAGCATGTGGG - Intergenic
1069234835 10:66058271-66058293 GAAAATGAAGCGAGGGAGGGAGG - Intronic
1069467488 10:68654650-68654672 GATAATTAATAGAACCAGGTGGG + Intronic
1069759589 10:70799414-70799436 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1070377789 10:75850729-75850751 GAAAATGCAGACAATCAGGATGG + Intronic
1070397384 10:76023322-76023344 AAAGATGAAGAAAAGCAGGCGGG + Intronic
1070547345 10:77463159-77463181 TGATATGAAGGGAAGCAGGTGGG - Intronic
1071064069 10:81610072-81610094 GAATCTAAAGAGATGCAGGTTGG + Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1071317477 10:84416231-84416253 GAAAATGAAGAAAAGCAGGGTGG - Intronic
1071397412 10:85237730-85237752 GGAAATGAAGAAAACCATGTGGG + Intergenic
1071764077 10:88642171-88642193 GAACCTGAAGAGTAGCAGATGGG + Intergenic
1072208137 10:93222323-93222345 AAAACTGATGACAAGCAGGTTGG - Intergenic
1072275275 10:93816685-93816707 AGAAAAGAAGAGAGGCAGGTAGG + Intergenic
1072413285 10:95225361-95225383 GACAGTACAGAGAAGCAGGTTGG - Exonic
1072496138 10:95961702-95961724 TAAAATGAAAAGAATAAGGTGGG + Intronic
1072970552 10:100013570-100013592 GACAGTGAAGAGGGGCAGGTGGG - Intergenic
1074237958 10:111605087-111605109 CTAAATGAAGACAACCAGGTTGG + Intergenic
1074813182 10:117125638-117125660 GGAAATGATGTGAAGGAGGTGGG - Intronic
1074914240 10:117940144-117940166 GGGACAGAAGAGAAGCAGGTGGG + Intergenic
1074947849 10:118298429-118298451 AAAAATGAAGAGTAACTGGTAGG - Exonic
1075237519 10:120744376-120744398 TAAAAGGAATAGAAGCAGCTGGG - Intergenic
1075688039 10:124377521-124377543 GAAAATGAATAAAGGGAGGTGGG + Intergenic
1076169821 10:128309819-128309841 GGCCATGGAGAGAAGCAGGTTGG + Intergenic
1076467921 10:130697734-130697756 TAGAATGAAGAGCAGAAGGTGGG + Intergenic
1076870793 10:133192843-133192865 GAAAGAGAAGAGAAGGAGGGTGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078501646 11:11885378-11885400 AAGAATGAAGAAAAGCAGGGTGG + Intronic
1078558323 11:12349459-12349481 GGAAATGATGAGCAGCAGCTAGG + Intronic
1079142332 11:17820206-17820228 GACAATGAAGAGAAGGGGCTTGG - Intronic
1079437800 11:20475320-20475342 GAGAAAGAAGAAAAGCAGGGTGG - Intronic
1080413896 11:32051774-32051796 GAAAAAGAAGTAAAGCAGGAAGG + Intronic
1081347422 11:42007316-42007338 GAAAATGAAGAGTAGAAGACTGG - Intergenic
1082651215 11:55796145-55796167 GAAGCTGAAAAGCAGCAGGTGGG - Exonic
1082976179 11:59075277-59075299 GAAAGAGAAGAGAAACAGATAGG - Intergenic
1083003890 11:59323085-59323107 GAAAAAGAAAAAAAGTAGGTGGG + Intergenic
1083465844 11:62845442-62845464 GAAAAAAAAGAAAAGCAGGCTGG - Intergenic
1083665795 11:64273872-64273894 AAAAAAAAAGAGAGGCAGGTAGG + Intronic
1083712958 11:64560015-64560037 GAACAGGAAGAGAGGCAGGAGGG - Intronic
1083911758 11:65713882-65713904 GAAAAGGAAGGGATGCAGGCAGG + Intronic
1083986478 11:66219114-66219136 GAGAAAGACCAGAAGCAGGTGGG + Intronic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1086073398 11:82823643-82823665 GAAAATGAAAAGAAACAAGGAGG + Intronic
1086081186 11:82903603-82903625 GAAAAGTAAGAGAGGCAGGCAGG - Intronic
1086368117 11:86128997-86129019 GAAAATGAGAGAAAGCAGGTGGG + Intergenic
1086485786 11:87299815-87299837 GTAAATGAAGAGAAGAAAGCAGG + Intronic
1086641639 11:89165528-89165550 GGAAAAGATGGGAAGCAGGTTGG + Intergenic
1086742112 11:90380492-90380514 GAAAACGAAGAAAAGCAAGGTGG - Intergenic
1086994837 11:93344506-93344528 GAAAAAGAAGGGAAGGAGGGAGG - Intronic
1086998517 11:93388342-93388364 AAAAATAAAGATAACCAGGTAGG - Intronic
1087093634 11:94299968-94299990 GAAAATGAAGAGGCTCTGGTTGG + Intergenic
1087232343 11:95680367-95680389 GAAAATGAAAACAAAAAGGTGGG + Intergenic
1087349854 11:97018240-97018262 GAAATTTCAGGGAAGCAGGTTGG + Intergenic
1087822594 11:102729159-102729181 GCATATAAAGAGAAGCAGCTTGG + Intergenic
1087932391 11:103993003-103993025 GAAAATGAAGAGTAGCTGTTAGG - Intronic
1088295675 11:108291144-108291166 GAAAATGGCCAGAACCAGGTAGG + Intronic
1088626749 11:111735194-111735216 GAAAAGGAAGAGGAGGAGGGTGG + Intronic
1088935454 11:114395353-114395375 GAAAATGAGGACAAGCAATTTGG + Intronic
1089668988 11:120039353-120039375 CAAAAGGAAGACAAGGAGGTGGG + Intergenic
1089991909 11:122869477-122869499 GAAAATGAAGAGAATCGGGATGG + Intronic
1090253405 11:125266315-125266337 GGAAATGAAGCAAAGCAGGAAGG - Intronic
1090650147 11:128799288-128799310 GAAAAGGAAGAGAAGCCTGAGGG - Intronic
1091109488 11:132952561-132952583 GATAGAAAAGAGAAGCAGGTTGG - Intronic
1091127552 11:133114614-133114636 GAAAATGGAGGGGAGCAGTTAGG - Intronic
1091148056 11:133298044-133298066 GAGTAAGAAGAGAAGCAGGAAGG - Intronic
1091197721 11:133746311-133746333 GAAACTGAAGAGTAACAGGAAGG - Intergenic
1091488228 12:910114-910136 GAACATAAAGAGAAGGGGGTGGG + Exonic
1091713301 12:2757992-2758014 AAAAACAAAGAGAAACAGGTGGG + Intergenic
1093151432 12:15626288-15626310 GAGAATGAAGAGAAATGGGTAGG - Intronic
1093376963 12:18441062-18441084 AAAACTGAAGAGAAGCAGTCAGG + Intronic
1094425206 12:30310076-30310098 GAGAACGAAGAAAAGCAGGGTGG + Intergenic
1094439373 12:30457606-30457628 GAAAATCAAGAGAGGGAGGTAGG - Intergenic
1094483299 12:30902375-30902397 GAAAAAGAAGAGAGGAAGGAAGG + Intergenic
1095961343 12:47836080-47836102 GATAAGGAAGGGAAGCGGGTGGG - Intergenic
1096606707 12:52771866-52771888 GAAAATGTCAAGAAGCAGGTGGG - Exonic
1096616701 12:52837138-52837160 GAAGATCAAGAGAAGCAGTGAGG - Intergenic
1096762612 12:53855018-53855040 ACAAGTGAAGAGAAGCAGTTAGG - Intergenic
1096767022 12:53899468-53899490 AAAAAGGAAGGGAAGCAGGAAGG + Intergenic
1097287123 12:57886968-57886990 GGAAGTGAAGAGAAGAAGGGAGG + Intergenic
1097386534 12:58956508-58956530 GAAAATAGAGAAAAGCAGGTGGG - Intergenic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1097910722 12:64966253-64966275 GAGAATGAAGAAAAGTAGGGAGG - Intergenic
1098009013 12:66030678-66030700 GAAAAAGAAGAAAAGAAGGGAGG - Intergenic
1098812863 12:75118389-75118411 CAAAATGAAGACAATAAGGTGGG + Intronic
1098974743 12:76890763-76890785 GAAAAAAAAGAGGAGGAGGTGGG - Intergenic
1099943398 12:89217351-89217373 GAAAAAGAAGGAAAGCAGGAAGG + Intergenic
1100100124 12:91092543-91092565 AAAAATGAAGAAAAGCAAGGTGG - Intergenic
1100156239 12:91803980-91804002 GAAAATGAAGAAAAGCAGGGCGG + Intergenic
1100312488 12:93409772-93409794 GGAAATGAATAAAAGCAGGGAGG + Exonic
1100650986 12:96588132-96588154 AAAAATGAAAAGAAACAAGTGGG - Intronic
1100801695 12:98238554-98238576 AAAGAGGAAGAGAAGCAGATGGG - Intergenic
1102138959 12:110598778-110598800 GAAAATGAAATTAAGAAGGTGGG + Intergenic
1103129797 12:118458248-118458270 AAAAATTGATAGAAGCAGGTGGG + Intergenic
1103265514 12:119627022-119627044 GAAAAGGCAGAGGAGCAAGTGGG + Intronic
1103412528 12:120722656-120722678 GCAAAGGAACAGAAGCAGGAGGG - Exonic
1104068793 12:125327447-125327469 GGAAATGAAGAGATTCTGGTAGG - Intronic
1104091454 12:125521215-125521237 GAAGAGGAAGAGAAGGAGGAAGG - Intronic
1104257813 12:127155224-127155246 GAATAAGACGAGAAGCAGATGGG - Intergenic
1104363856 12:128158884-128158906 AGAAAAGAAGAGAAGAAGGTGGG + Intergenic
1104649160 12:130518975-130518997 CAAAAGGAAGAGAAGCAGAAGGG + Intronic
1104750652 12:131236062-131236084 GAAAGAGAAGAGCAGCAGGATGG - Intergenic
1105427988 13:20312313-20312335 CAGAATGAAGAGATGCATGTGGG + Intergenic
1105622812 13:22085468-22085490 GAAAAGGAAGAAAAGAAGGAAGG + Intergenic
1105869721 13:24493932-24493954 GAACAGGAAGAAAAGCGGGTAGG - Intronic
1106047724 13:26160522-26160544 GAAGAAGAAGAGAAGAAGATAGG - Intronic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106526434 13:30544751-30544773 GAACCTGAGGAGAAGGAGGTGGG + Intronic
1107119016 13:36778063-36778085 GAGAAGGAAGAAAAGCAGGGTGG + Intergenic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107267984 13:38580097-38580119 GAAAAAGAAGAGATACATGTTGG + Intergenic
1107661463 13:42643464-42643486 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1107664411 13:42674233-42674255 GAAGATGAAGGGAAGGAGATAGG + Intergenic
1107698651 13:43024673-43024695 ACAACTGAAGAGAAACAGGTGGG + Intronic
1108918787 13:55651797-55651819 AGAAATGAATAGAAGAAGGTTGG - Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109582510 13:64361192-64361214 TAAAAAGAAGAGAAGAAGGATGG - Intergenic
1110505481 13:76280936-76280958 GGAAATGAAGAGAAAGAGGCAGG - Intergenic
1110602969 13:77397121-77397143 AAAAAAGAAGAGAGGCAGGAAGG - Intergenic
1110618047 13:77563243-77563265 GAAAATGAAAAGGAGAAAGTGGG - Intronic
1110692635 13:78449310-78449332 GAAGATGAAGAGAAGAAGACAGG - Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111418855 13:87983771-87983793 GCAAGAGAAAAGAAGCAGGTAGG - Intergenic
1111626540 13:90795159-90795181 GAAAAAGAAAAGAAGGAGGGAGG - Intergenic
1111641543 13:90976844-90976866 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
1112401704 13:99084355-99084377 CAAAATGCAGGGAAGCAGGTGGG - Intronic
1112748296 13:102552758-102552780 GGAAAGGGAGAGAAGCCGGTGGG + Intergenic
1112759691 13:102680434-102680456 GCCTAAGAAGAGAAGCAGGTGGG - Intergenic
1112873764 13:104008987-104009009 GCAAACGAAGAGAATCAGATTGG + Intergenic
1113196844 13:107818255-107818277 AAAAAGGAAGAGCAGCAGGTGGG - Intronic
1113296350 13:108963452-108963474 GAAAATGAAGGGAAGGCAGTAGG - Intronic
1113299410 13:109001195-109001217 GAAAAGGAAGAGAAGGGGATTGG + Intronic
1114046817 14:18882513-18882535 GAAAAAGAAGAAAAGGAGTTTGG + Intergenic
1114117396 14:19636933-19636955 GAAAAAGAAGAAAAGGAGTTTGG - Intergenic
1114207592 14:20587558-20587580 GAAACTGAACAGGAACAGGTAGG - Exonic
1114281317 14:21194837-21194859 GAGAAAGAAGAGAAGAAGGAAGG - Intergenic
1115410252 14:33066145-33066167 GAAAATGAGAAGCAGCAGCTCGG + Intronic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1116317773 14:43418583-43418605 GAAAATGAAGAAAAGCATGGTGG - Intergenic
1116333653 14:43628731-43628753 GAAAATGAAGAGTAGAATGATGG + Intergenic
1116388102 14:44357638-44357660 GAAAAATAAGAGAAGAAGGCAGG + Intergenic
1116751964 14:48897808-48897830 GAAAATGAAGAATTGGAGGTTGG + Intergenic
1117503211 14:56374663-56374685 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1118038312 14:61892056-61892078 GAAAAGGAAGGGAAGGAGGGAGG - Intergenic
1118063147 14:62162568-62162590 GAAAAAGAAGAGAAAGAGGAGGG - Intergenic
1118231561 14:63955798-63955820 AAAAATGAACAGAAGCATTTTGG - Intronic
1118604069 14:67490312-67490334 GAGAATGAAGAGAGGCAGAGTGG + Intronic
1118635733 14:67747420-67747442 GAGACTGAAGGGAAGCAGGAGGG + Exonic
1118717374 14:68569868-68569890 AAAAGTGAGGAGAGGCAGGTGGG + Intronic
1119070646 14:71579915-71579937 GAAAAAGAAGACAAGTATGTAGG - Intronic
1119147244 14:72328534-72328556 GAAACTGAAGTGAAGGGGGTAGG + Intronic
1119422943 14:74518366-74518388 GAAACAGATGAGAAGCAGGCTGG - Intronic
1119463832 14:74836522-74836544 GAAAGTGAAAAGAAGAAGGAAGG - Intronic
1119464361 14:74843102-74843124 GCAAATTAAGAGAAGATGGTAGG - Intronic
1119781463 14:77279010-77279032 GAAACTGGAGAGGAGCAGCTGGG + Intronic
1119859213 14:77924432-77924454 GAAAGAGAAGAGGGGCAGGTGGG - Intronic
1119897538 14:78232662-78232684 GATAGGGAAGAGAAGCAGGGAGG - Intergenic
1119976403 14:79029094-79029116 GAGAATGAAAAGAAGGGGGTTGG + Intronic
1120282992 14:82463269-82463291 GAGAAAGAAGAAAAGCAGGAAGG + Intergenic
1120515190 14:85462178-85462200 AAAAAGGAAGAGAGGCAGGCAGG - Intergenic
1120674327 14:87403343-87403365 CACAAGGAAGAGAAGTAGGTAGG - Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121576160 14:94989819-94989841 GCAAATGGACAAAAGCAGGTTGG + Intergenic
1124004882 15:25787644-25787666 GAAAAAGAAAAGAAAAAGGTGGG + Intronic
1124916287 15:33977991-33978013 GAAAAGGAAGAGAGGAAGGGAGG + Intronic
1124923215 15:34046785-34046807 GAAAACAAAGAAAAGCAGGGTGG + Exonic
1124993852 15:34703495-34703517 GAAGAAGAAGAGAAGGAGGAGGG - Intergenic
1125026217 15:35032004-35032026 GGAAATGAAGAGAAGAATTTTGG + Intergenic
1125054617 15:35342458-35342480 GAGAAAGAAGAAAAGCAGGGTGG - Intronic
1125305231 15:38304786-38304808 GAAATTGAAGAGCAGTAGGAGGG - Intronic
1125306760 15:38326132-38326154 GAAAATGAAGAAAACCATATTGG + Intronic
1125410147 15:39397675-39397697 GAAAATGATGAGGATCATGTTGG - Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1126362780 15:47863458-47863480 GAAAAAGAAGAGGAGAAGGAGGG + Intergenic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1126860236 15:52876028-52876050 GAAGATGGATAGAAACAGGTGGG - Intergenic
1126938507 15:53739177-53739199 GAGAATGAAGTGAAGAAAGTAGG + Intronic
1127040984 15:54976468-54976490 ACAAACGAAGAGAAGCAGTTGGG - Intergenic
1127435457 15:58953088-58953110 GCAAGAGAAAAGAAGCAGGTAGG - Intronic
1127937762 15:63659409-63659431 AAAAATGAAGAAAAGTAGCTGGG - Intronic
1128751020 15:70149012-70149034 GAAAAGTGAGAGAATCAGGTTGG + Intergenic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130063736 15:80588091-80588113 GAGAATGGAGGAAAGCAGGTAGG + Intronic
1130779141 15:87016684-87016706 GAGAATGAAGAAAAGCAGGATGG + Intronic
1131967465 15:97859436-97859458 GACAAGGTAGAGAAGCAGGAAGG - Intergenic
1132252687 15:100346059-100346081 GCAAGTGAAGAGAGGCTGGTGGG - Intergenic
1132432351 15:101772194-101772216 GACAAGGAAGAGATGAAGGTAGG - Intergenic
1132741654 16:1416554-1416576 GAAAATGAAGTCAAGCAGGAAGG + Intergenic
1132850205 16:2021628-2021650 TAAAAGGCAGAGAAGCAGGCCGG - Intergenic
1133475871 16:6121441-6121463 TGAGATGAAGAGAAGCAGGTAGG - Intronic
1133905467 16:10018336-10018358 GAAACATAAGAGAAGAAGGTGGG + Intronic
1134318242 16:13139425-13139447 GAAGAGGAAGAGAAGAAGGAAGG - Intronic
1134397751 16:13880842-13880864 GAACATAAACAGAAGTAGGTAGG - Intergenic
1134836775 16:17367980-17368002 GGAAGTGAAGAAAAGCAGGGAGG - Intronic
1135175421 16:20223566-20223588 AAAAAAGGAAAGAAGCAGGTTGG - Intergenic
1135393876 16:22116266-22116288 GAAAAAGAAAAGAAGAAGGAAGG + Intronic
1135882682 16:26274112-26274134 GAGAATGGAGAGAAGAAGATGGG - Intergenic
1135904669 16:26500263-26500285 GAAAAAAAAAAGAAGAAGGTGGG + Intergenic
1136901076 16:34038655-34038677 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1136968338 16:34942061-34942083 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1137355725 16:47761566-47761588 AAACATGAAGAGAATCAGGGAGG + Intergenic
1137529193 16:49266316-49266338 GAAAATGACAAGAGTCAGGTGGG + Intergenic
1137746863 16:50828591-50828613 GAAAGAGAAGAGAAGAAGGAAGG - Intergenic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139613740 16:68076605-68076627 GGAAAGGAAGGGAAGCAGTTGGG - Intronic
1139961632 16:70721382-70721404 GAAGAGGAAGAGGAGGAGGTGGG + Intronic
1140113277 16:72021356-72021378 GAGAATGAAGGGGAGCAGGTGGG - Intronic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1141090272 16:81125453-81125475 GAAAAAGAAGAAAAGGAGGCTGG + Intergenic
1141531658 16:84650194-84650216 GAAGATGCAGAGAAGCACTTGGG + Intronic
1141828468 16:86496841-86496863 GAAAATGAAAAGGAGCAGAGCGG + Intergenic
1141984825 16:87572868-87572890 GAGACTGCAGAGAACCAGGTGGG - Intergenic
1142366024 16:89650166-89650188 GAAAAAAAAGAAAAGAAGGTAGG - Intronic
1142928323 17:3260302-3260324 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
1143392675 17:6569230-6569252 GAAAAAAAAGAAAAGCAGATGGG + Intergenic
1143525991 17:7472942-7472964 AAAAAAAAAGAGAAGCAGTTGGG - Intronic
1143799388 17:9366073-9366095 GAAAATGAAGCTAGGCAGGCTGG - Intronic
1143951579 17:10636936-10636958 GACAATGAAGAAAAGAAGTTTGG - Intronic
1144396161 17:14845175-14845197 GAAAAGGAAGAGAGGAAGGGAGG + Intergenic
1144969089 17:19095921-19095943 GGAAAGGAAGAAAAGCAGGAAGG + Intronic
1144978827 17:19156145-19156167 GGAAAGGAAGAAAAGCAGGAAGG - Intronic
1144989395 17:19222087-19222109 GGAAAGGAAGAAAAGCAGGAAGG + Intronic
1145722661 17:27088352-27088374 GAGAAGGAAGAGAGGGAGGTAGG - Intergenic
1145770476 17:27489349-27489371 GAAGATGAAGAAAAGCAGAAGGG - Intronic
1146657420 17:34643011-34643033 GAAAGTGAAGGGAATGAGGTTGG + Intergenic
1146890546 17:36503831-36503853 GGAAATGAAGAGAAAGAGGCTGG - Intronic
1146949015 17:36892838-36892860 GAAAATGAAGAGTTGGAGTTTGG - Intergenic
1147196063 17:38767639-38767661 CCAAATGCAGAGAAGCCGGTAGG + Exonic
1147205092 17:38831630-38831652 GAAAATGAAGGAAAGAAGGAAGG - Intergenic
1147240302 17:39086414-39086436 GAAGAGGAAGAGAAGGAGGGAGG - Intronic
1147751146 17:42734450-42734472 GAAAATGAAGATTACCAGCTGGG + Intronic
1148022361 17:44561871-44561893 GAAAAGCCAGAGAATCAGGTGGG + Intergenic
1148574475 17:48699824-48699846 GAAAAAGAAGAAAAGGAGGCTGG + Intergenic
1148947981 17:51282458-51282480 GAAAATGAAGAGAAAGAGGAAGG + Intronic
1149037451 17:52151038-52151060 GAAAAAGAAGACAAGGAGTTGGG + Intronic
1150469365 17:65423652-65423674 GAAGATGAAAAGTACCAGGTGGG + Intergenic
1150543623 17:66130010-66130032 GAAAAAGAAGAGAAAGAAGTGGG + Intronic
1150813980 17:68378367-68378389 GAAAGGGAAGACAAGCAGGGGGG - Intronic
1151150328 17:72079630-72079652 GAAAAGGATGAGAAGCAGAGGGG + Intergenic
1151162274 17:72175665-72175687 GCAAAGGCAGAGAAGCAGGGAGG - Intergenic
1151250680 17:72831978-72832000 GAAGAGGAGGAGAAGGAGGTTGG + Intronic
1151888435 17:76937962-76937984 GAAAAAGAAGAGGAGGAGATGGG - Intronic
1152099241 17:78291529-78291551 GAGACTGAAGAGCAGCAGGGAGG + Intergenic
1152208070 17:78986830-78986852 GCAAGAGAAGAGAAGCAGGCAGG + Intergenic
1153147338 18:2048200-2048222 GAAAATGAGGAGTGACAGGTGGG - Intergenic
1153324912 18:3808713-3808735 GAAAACGAGGAGCAGTAGGTAGG + Intronic
1153325435 18:3814314-3814336 GAAAAAGAAAAGAAAAAGGTAGG - Intronic
1153349967 18:4068697-4068719 GGACCTGAAGAGAAGCAGCTAGG + Intronic
1153679497 18:7486733-7486755 AAAAATTAAGAGGAGCAGGGAGG - Intergenic
1153939995 18:9969191-9969213 GAAGATGAGGAGAAGCAGGCGGG - Intergenic
1154214435 18:12405675-12405697 GAAAAGGAAGAGAGGGAGGGAGG + Intergenic
1155222513 18:23698180-23698202 GAAGAAGAAGAGAAACAGGCTGG - Intronic
1155222922 18:23701713-23701735 GAGGATGAAGAGAAGCGGGTAGG + Intronic
1155373898 18:25135362-25135384 GAGAAGGAAAACAAGCAGGTTGG - Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156257424 18:35411075-35411097 GAAGGTGGAGAGGAGCAGGTTGG + Intergenic
1156332214 18:36132957-36132979 GAGAGTGAGCAGAAGCAGGTGGG + Intronic
1156746836 18:40402630-40402652 GAAAAAGAACAGAAGGAGGAGGG + Intergenic
1157054850 18:44214815-44214837 GAAAAATGAAAGAAGCAGGTAGG + Intergenic
1157068030 18:44374709-44374731 GAAAGTGAGCAGAAGCAGGGTGG + Intergenic
1157434500 18:47657003-47657025 GAAAATACAGAGAAGCATGCAGG + Intergenic
1158329039 18:56341160-56341182 GTAAATGATGAGAAGAAAGTAGG + Intergenic
1158869899 18:61675901-61675923 GAAAATGAATAGAAGTGTGTAGG + Intergenic
1159127611 18:64242842-64242864 TAAAATGCAGGGAGGCAGGTAGG + Intergenic
1159207868 18:65277355-65277377 AAAAATGTAGGGAAGCAAGTTGG - Intergenic
1159730900 18:72026245-72026267 GAACATGGAGAGTAGCAGGATGG - Intergenic
1159864543 18:73688628-73688650 GCAAGAGAAAAGAAGCAGGTAGG + Intergenic
1159931177 18:74314806-74314828 GGAAAGGAAGAAAAGCAGTTAGG - Intergenic
1159975348 18:74704401-74704423 GAAAATGAAGGGAAAAAGGCCGG + Intronic
1160715831 19:576162-576184 GAAAGTGAGGAGGACCAGGTGGG - Intronic
1161117632 19:2507561-2507583 GAAAAAGAAGAGAGGGAGGGAGG - Intergenic
1161458430 19:4381639-4381661 GGAAATGAAGAGAGGCAGAGGGG - Intronic
1161692213 19:5742796-5742818 GAAAAAGAAAAGAAACTGGTTGG + Intronic
1161828991 19:6589334-6589356 GAAAAGAAAGAGAAGAAGGAAGG - Intronic
1161905159 19:7151027-7151049 GAAAATGAAAAAAAGAAGGAAGG - Intronic
1162000161 19:7739433-7739455 AAGAATGAAGAGGAGCAGGTAGG + Intergenic
1162004895 19:7771450-7771472 GAAAGTGAAGAGGGGCAGGTAGG - Intergenic
1162082290 19:8225372-8225394 GACAGTGAATAGAAGCAGGAAGG + Intronic
1164643013 19:29840211-29840233 AAGAAGGAAGAGAAGAAGGTTGG - Intergenic
1165746445 19:38232708-38232730 CAGCATGAAGAGAATCAGGTGGG + Intergenic
1165874467 19:38996229-38996251 GGAAAGGAAGAGAAGCAGGCTGG - Intronic
1166588022 19:43968727-43968749 GAAAATGAAGAAAAGTAGGGTGG + Intronic
1166691809 19:44826201-44826223 GAGAAGGAAGAGAGGCAGGGAGG + Intergenic
1167005956 19:46776864-46776886 GAAGAGGAAGAGAAGAAGGAAGG - Intronic
1168368786 19:55813695-55813717 GATGATCAAGAGAAGCAGGAAGG + Intronic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925442408 2:3899802-3899824 GAAAATGAAGAAAAGCAGGGTGG - Intergenic
926987618 2:18640732-18640754 GAAAATGAAGAAAAACAGGGTGG - Intergenic
927996991 2:27493783-27493805 GAAAGGAAAGAAAAGCAGGTGGG - Intronic
928125063 2:28609849-28609871 GAAAAGGAAGAGGGACAGGTGGG - Intronic
928638425 2:33272292-33272314 GAATGAGAAGAAAAGCAGGTGGG - Intronic
929050858 2:37835444-37835466 AAAAATGAAGAGAAGCGGCCGGG - Intergenic
929100264 2:38304845-38304867 TAAAAGGAAGACAGGCAGGTAGG + Intronic
929694070 2:44099270-44099292 GTATAGGAAGAGGAGCAGGTTGG - Intergenic
929866587 2:45722586-45722608 GAAGATGAGGAAAAGCAGATAGG + Intronic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930458063 2:51631995-51632017 GAAAATGTACTGAAGCATGTTGG + Intergenic
931371269 2:61665350-61665372 AAAAATTAATAGAAGCAGGACGG + Intergenic
931463926 2:62470668-62470690 GAAGGTGAAGAGAAGCTGGTGGG - Intergenic
931829753 2:66038532-66038554 GAGGATGAAGAGCAGCAGGCTGG - Intergenic
931884608 2:66603495-66603517 GAAAAGGAAGAGAAGAAGGAAGG - Intergenic
931918785 2:66989444-66989466 GAAAATGTATAGCAGCAGGATGG - Intergenic
932323459 2:70838602-70838624 GAAAAGACAGAGAAGCAGGCAGG + Intergenic
932407194 2:71521509-71521531 GAAGCAGAAGAGAGGCAGGTGGG + Intronic
932666209 2:73700947-73700969 GAATCTGAAGAGAAGGTGGTGGG - Intergenic
932842216 2:75094288-75094310 TAAAATAAAGAGAAGTAAGTAGG + Intronic
933161184 2:79026665-79026687 TAAAATGAAGAGTAGGGGGTGGG - Intronic
933244955 2:79964780-79964802 TAAAATGAAGAGAAGCAACGAGG - Intronic
933299291 2:80524373-80524395 GAAAATGAGAAAGAGCAGGTAGG - Intronic
933325304 2:80828393-80828415 GACAAAGAAAAGAAGAAGGTTGG - Intergenic
933346288 2:81089785-81089807 GAAAATTAAGAGATTCAAGTTGG + Intergenic
934536979 2:95142562-95142584 AAAAATGAAGTGAACCTGGTAGG - Intronic
934548570 2:95240301-95240323 AAGAATGAAGAAAAGCAGGGTGG + Intronic
935039302 2:99410610-99410632 GAAAATGAAGAAAACCAAGGAGG - Intronic
936504193 2:113092034-113092056 GAAAAGGAAGGGAAGAAGGAAGG + Intergenic
936561615 2:113543430-113543452 GAAAATGAAAAGGAGAGGGTTGG - Intergenic
937187462 2:120058044-120058066 GCAAAAGAAGGGAAGCAGGTTGG + Intronic
937188280 2:120067277-120067299 GAGAATGGAGAGAAGCAGCTAGG + Intronic
937720051 2:125083955-125083977 GAAAAAGAAAAGAAGCAACTTGG + Intergenic
938519129 2:132048690-132048712 GAAAAGGAAGAAAAGAAGGGAGG - Intergenic
938519150 2:132048838-132048860 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
939039464 2:137170671-137170693 GGAAAGGAAAAGAAGCAGCTGGG - Intronic
939177955 2:138772046-138772068 GAATATGAGGACAAGCAGGTGGG - Intronic
939408571 2:141793823-141793845 GAAAATGAAGAGAAAAAAGAAGG - Intronic
940189817 2:151028699-151028721 AGAAATGAAGAGAATCAGATTGG + Intronic
940720009 2:157271675-157271697 GGAAATGCAGAGGAGCTGGTTGG + Intronic
940769714 2:157826843-157826865 GAAAAGGAAAAGAAGAAGGAAGG + Intronic
941128923 2:161622421-161622443 GAAAGTGAAGAGAAACAGATGGG - Intronic
941827603 2:169917301-169917323 GAAGAAGGAGGGAAGCAGGTTGG - Intronic
942477991 2:176349292-176349314 GAAAAGGAAGAGAAGGAGAAGGG - Intergenic
942535022 2:176954298-176954320 AGAAATGAAGAGAAGGAGGAAGG + Intergenic
942572042 2:177324509-177324531 CAAAATGAAGAGGAGGGGGTGGG - Intronic
943183218 2:184571531-184571553 GACAATGAAAAAAAGCAAGTAGG + Intergenic
943187152 2:184625118-184625140 GAAAATGTCAAGAATCAGGTTGG + Intronic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
943821834 2:192333293-192333315 GAAAAGGAAGAGAGGGAGGGAGG - Intergenic
944071471 2:195674571-195674593 GTAAATAAAGAAAAGCAGGCCGG - Intronic
944824717 2:203470483-203470505 GAAAAAGAAAAGGAGCAGGGAGG + Intronic
944855531 2:203763618-203763640 TTAAATGAAGAAAAACAGGTGGG - Intergenic
945423433 2:209667884-209667906 GAAAATGAAGAGAAGGGATTGGG - Intronic
945874120 2:215259416-215259438 GAAAAGGAAGAAAAGAAGGAAGG + Intergenic
945945806 2:215994611-215994633 GAAGAAGAAGAGAAGAAGGAGGG + Intronic
946026733 2:216676386-216676408 GAAAAGGAAGACAAGCAGGTGGG - Exonic
946332459 2:219018132-219018154 GAGAATGAAAATATGCAGGTGGG - Intronic
946518957 2:220445746-220445768 GAAAATGAAGAAAAAAATGTTGG + Intergenic
946629810 2:221654901-221654923 TAAAAAGAAGAGGAGCAGGGTGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946786248 2:223246884-223246906 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947999545 2:234556376-234556398 GATAAAGAAGAGTAGGAGGTAGG - Intergenic
948547310 2:238742082-238742104 GAAAAAGAACAGAGGCAGGGTGG + Intergenic
1169142763 20:3235536-3235558 GAACATGAAGAGGAGCACGATGG - Intronic
1169217437 20:3801785-3801807 GAAAAGGAAGAGGAAAAGGTGGG + Exonic
1169305091 20:4482685-4482707 GAAAAGGAAGAAAAGAAGGAAGG - Intergenic
1169390032 20:5182960-5182982 AAAACTGCTGAGAAGCAGGTAGG - Intronic
1169484272 20:6013499-6013521 GAGAATGAATGGATGCAGGTAGG + Intronic
1169960966 20:11159689-11159711 GGAAATTGAGAGGAGCAGGTTGG - Intergenic
1170135264 20:13066768-13066790 GGAAAGGAAGAGAAGGAGGAGGG - Intronic
1170589780 20:17763096-17763118 GAAGAGGAAGAGAAGGAGGGAGG - Intergenic
1170948195 20:20910864-20910886 TAAAATGAAAAGAATCAGCTGGG + Intergenic
1171085451 20:22234398-22234420 GAGAAAGAAGAGTGGCAGGTTGG + Intergenic
1171936089 20:31276922-31276944 GAAAATAAAGAGAAACATTTGGG - Intergenic
1172206196 20:33164499-33164521 GAAAAGGAAGAGAAGAAGGGAGG - Intronic
1172322391 20:34006254-34006276 CAAAATGAAGAAAAGTAGGTAGG - Intronic
1173048694 20:39538005-39538027 GAAAATCAAGAGAAGCCATTAGG + Intergenic
1173835639 20:46123498-46123520 AAAACTGAGGAGAAGCAGGAGGG - Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174758371 20:53182144-53182166 GAAAAGGAAGAGAGGGAGGGAGG - Intronic
1175149049 20:56918683-56918705 GAAGACCCAGAGAAGCAGGTGGG + Intergenic
1175554777 20:59842249-59842271 GAAAATTAATAGAAGCAAGAAGG - Intronic
1175610345 20:60346110-60346132 GAAAAAGTAGATAAGCAGGAAGG + Intergenic
1176419270 21:6500800-6500822 GCAAGAGAAAAGAAGCAGGTTGG + Intergenic
1176522830 21:7837870-7837892 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1176637715 21:9264113-9264135 TAAAAAGAAAAGAAGGAGGTTGG - Intergenic
1176742564 21:10617389-10617411 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1177117513 21:17104442-17104464 GAGAATGAAGAAAAGCAAGGTGG + Intergenic
1177511914 21:22098372-22098394 GAAAATGGGGAGAAACGGGTTGG - Intergenic
1177895103 21:26847289-26847311 GAAGTCGAAGAGAAGGAGGTAGG - Intergenic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1178449505 21:32682894-32682916 GAAAATGAAAGCAAGCATGTTGG - Intronic
1178586653 21:33876199-33876221 GAAAAAGAAGAGAGGAAGGAAGG - Intronic
1178586657 21:33876252-33876274 GAAAAAGAAGAGAGGAAGGAAGG - Intronic
1178656850 21:34467882-34467904 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1178744759 21:35238197-35238219 GAAAACGAAGTGAAGCAGGAAGG + Intronic
1178925273 21:36769531-36769553 GAAAATATACAGAAGCAGGGAGG - Intronic
1179003776 21:37490495-37490517 GAAATTAAATAGAAGTAGGTAGG + Intronic
1179163434 21:38916693-38916715 GAAAAGGAAGAGAAAAAGGAAGG + Intergenic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179409757 21:41153667-41153689 GGAAAGGAAGAGAAGAAGGAAGG + Intergenic
1179484000 21:41698005-41698027 GAAGAGGAAAAGAAACAGGTGGG - Intergenic
1179694763 21:43109122-43109144 GCAAGAGAAAAGAAGCAGGTTGG + Intergenic
1179989954 21:44942689-44942711 GGAAATGAAGACAAGGAAGTGGG + Intronic
1180204674 21:46251302-46251324 GAAAAAGTAAAGAAGCAGGCTGG + Intronic
1180242345 21:46518370-46518392 GATAATGATGGGGAGCAGGTAGG - Intronic
1180421758 22:12871610-12871632 TAAAAAGAAAAGAAGAAGGTTGG - Intergenic
1180825103 22:18856280-18856302 GAAAAGGAAGGTGAGCAGGTTGG + Intronic
1180897275 22:19345841-19345863 GAAAATGAGAAGCAGAAGGTTGG - Intronic
1180934970 22:19619474-19619496 GAAAATGAAGCTAAGCTTGTTGG + Intergenic
1181187626 22:21118267-21118289 GAAAAGGAAGGTGAGCAGGTTGG - Intergenic
1181211572 22:21292226-21292248 GAAAAGGAAGGTGAGCAGGTTGG + Intergenic
1181289996 22:21784396-21784418 GAAAATGAAAATAAGCAGCCAGG + Intronic
1181397935 22:22634660-22634682 GAAAAGGAAGGTGAGCAGGTTGG - Intergenic
1181500683 22:23314031-23314053 GAAAAGGAAGGTGAGCAGGTTGG - Exonic
1181651471 22:24261398-24261420 GAAAAGGAAGGTGAGCAGGTTGG + Intergenic
1181705905 22:24649341-24649363 GAAAAGGAAGGTGAGCAGGTTGG - Intergenic
1181904218 22:26180705-26180727 GAAAATGAAGAGAAGCCTCAAGG + Intronic
1182550015 22:31095825-31095847 GAAGGAGAAGAGAAGCTGGTTGG - Intronic
1183101736 22:35588429-35588451 AAAAATGAACAGGAGCAGGGTGG - Intergenic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
1184135929 22:42549901-42549923 GAAAGTGAAGAGAGGCAGGTGGG + Intergenic
1184890745 22:47377537-47377559 GAAAATTTAAAGAAGAAGGTAGG + Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1203215378 22_KI270731v1_random:3206-3228 GAAAAGGAAGGTGAGCAGGTTGG - Intergenic
1203237720 22_KI270732v1_random:21962-21984 GAAAATAAAGAGGAGAAGGAGGG + Intergenic
1203275249 22_KI270734v1_random:82186-82208 GAAAAGGAAGGTGAGCAGGTTGG + Intergenic
949379077 3:3424431-3424453 GGAAATGAAGAGCAACAGGAAGG + Intergenic
950072206 3:10161705-10161727 GAAGAGAAGGAGAAGCAGGTAGG + Intergenic
950173963 3:10858965-10858987 GTATATGAAGAGAAACAGGCTGG + Intronic
950861647 3:16152669-16152691 CATAAGCAAGAGAAGCAGGTTGG - Intergenic
951188777 3:19745052-19745074 GAAAATTAAGTGAAACAGTTAGG - Intergenic
951297782 3:20960477-20960499 GAATAGAATGAGAAGCAGGTTGG - Intergenic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
951711210 3:25586176-25586198 GAACATGAGGAGAAGAGGGTGGG - Intronic
951972986 3:28469280-28469302 TAAAAGGAAGAGAAGAAGGAAGG + Intronic
952649380 3:35707065-35707087 GATAAAGAAGACAATCAGGTTGG + Exonic
952829883 3:37555816-37555838 GAAACAGAACAGAAGAAGGTTGG + Intronic
952871084 3:37902029-37902051 GAAAAAGTAGAGAAGGAGGAAGG + Intronic
952991627 3:38835799-38835821 GGAAAGGAAGAGAAGCAGTCAGG - Intergenic
953052820 3:39361634-39361656 GAGAATGAAGAAAAGCAGGTTGG + Intergenic
953083694 3:39646083-39646105 GATAAGGAAGAGATGGAGGTTGG - Intergenic
954365177 3:50141860-50141882 GAAAAAGAAGAGAGGAAGGAAGG - Intergenic
954529367 3:51304753-51304775 GAAAGTGAGGAAAAGCAGGGTGG - Intronic
954834445 3:53453479-53453501 GCAAAGGAGGAGAAGCAGGGTGG - Intergenic
954894473 3:53964010-53964032 GAGAAAGAAGAGAACCAGGGAGG - Intergenic
954898947 3:54002594-54002616 GGAAAGGAAGGGAAGGAGGTGGG - Intergenic
954999258 3:54911705-54911727 TAAAATGAAGAGGTGAAGGTTGG - Intronic
955202955 3:56867835-56867857 GAAAATGAGGAAGACCAGGTTGG + Intronic
955208823 3:56921779-56921801 TAAAATGATGAGAAGAATGTGGG + Intronic
955885699 3:63596257-63596279 GAAAGGGAAGAGAAGAAGGGGGG - Intronic
956219298 3:66884717-66884739 GAAAGGGAAGAGAAGGAGGGAGG + Intergenic
956316290 3:67941343-67941365 GAAAAGGAAGAAAAGGAGGAAGG - Intergenic
956321447 3:68001137-68001159 GAAAAGGAGGTGAAGCTGGTGGG + Intergenic
956440955 3:69279879-69279901 GAAAATGTGGAAAAGCAAGTAGG - Intronic
956684422 3:71811066-71811088 AAAAAGGAAGAGAAGCATGAAGG + Intergenic
956849728 3:73217806-73217828 GAAAAGGAAGGGAAGGAGGGAGG - Intergenic
956849747 3:73217900-73217922 GGGAAGGAAGAAAAGCAGGTAGG - Intergenic
956870494 3:73412528-73412550 GAAGATGCAGAGGAGCAGGCAGG + Intronic
957419360 3:79949322-79949344 GTGAATGAAGAGAAGTAGATTGG + Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957798790 3:85047663-85047685 GAAAATGAGGATAAGTAGCTTGG + Intronic
958433553 3:94070659-94070681 GAAATTGGAGAAAGGCAGGTTGG - Intronic
958532527 3:95351577-95351599 GAACATTAAGAGGAGCAGGAAGG + Intergenic
958598907 3:96267812-96267834 GAAGAGGAAGTGAGGCAGGTTGG + Intergenic
958640799 3:96801519-96801541 GAGAATGCAGAAAAGCAGGGTGG - Intergenic
959173934 3:102880713-102880735 GAAAATGGTGAGAAACAAGTAGG - Intergenic
959540694 3:107534468-107534490 GAAGAAGAAGAGAAGGAGGGAGG - Intronic
960374974 3:116889557-116889579 AAGAATGAAGAGAAGTGGGTCGG + Intronic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
960616400 3:119599819-119599841 GGAAAGGAAGAGAAGCGGATGGG - Intronic
960814441 3:121658476-121658498 GAAAATGAAGCAAAGCAAATGGG + Intronic
961175130 3:124829163-124829185 GAAAATGTAGATAAGCAGAAAGG - Intronic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
961571636 3:127803404-127803426 GAGAATTAGAAGAAGCAGGTGGG - Intronic
961678285 3:128581702-128581724 GCAAGAGAAAAGAAGCAGGTAGG + Intergenic
961692356 3:128679287-128679309 GAAAACAAAGAGAAGAGGGTTGG - Intronic
961804007 3:129475831-129475853 AAAAATGAAGAGAAGTAGTATGG + Intronic
962336587 3:134537286-134537308 TAAAATAATGAGAAGCAGATAGG + Intronic
962658119 3:137570338-137570360 GAAAATGAAGAAAAGGAGTAAGG - Intergenic
962724548 3:138210450-138210472 AAAAATTAAGAGAAGCAAGTAGG + Intronic
962878270 3:139552704-139552726 GAGAAGGAAGAAATGCAGGTAGG - Intergenic
962981870 3:140497974-140497996 GAGAAGGAAGAAAAGCAGGGTGG - Intronic
962984497 3:140522173-140522195 GGGAATGAAGAAAAGCAGGCTGG - Intronic
963268048 3:143258648-143258670 GAAAATGGAGACAAGGAAGTCGG - Intergenic
963949978 3:151188899-151188921 GAGAGTGTAGAGAAGCAGCTAGG - Intronic
964401701 3:156306477-156306499 TAAAGTGAAGAGATGCAGGGAGG - Intronic
964426953 3:156563703-156563725 AAAAATGAAGGAAAGAAGGTTGG - Intergenic
964450197 3:156805093-156805115 GAAAAAGAAGCCAAGCAGGTGGG - Intergenic
964581838 3:158247881-158247903 AAAACTGAAGAAAAGCAGGGTGG - Intronic
964832818 3:160904569-160904591 GAAGATGAACTCAAGCAGGTGGG + Intronic
964899491 3:161640996-161641018 GAAAAAGAACAGAAGTTGGTTGG - Intergenic
965464276 3:169007486-169007508 GCAAGAGAAAAGAAGCAGGTGGG - Intergenic
965739057 3:171853614-171853636 GAAAATGAATAGAAGCAATATGG - Exonic
966133414 3:176670646-176670668 GAAGAGGAAGAGAGGCAAGTGGG - Intergenic
966152047 3:176875817-176875839 GAGAATGAAGAAAAGCAAGTCGG - Intergenic
966454674 3:180101876-180101898 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
967171053 3:186824119-186824141 GAAAAGAAAGAGAAGCAGAAAGG - Intergenic
967272199 3:187741094-187741116 GAAAATAAAGAGGGGCGGGTAGG - Intronic
967481340 3:189976762-189976784 AAAAATTAAGAGAAGCAATTAGG - Intronic
967486069 3:190032529-190032551 GGAAATGCAGGCAAGCAGGTTGG + Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967574590 3:191076146-191076168 GAGAATGAAGAAAAGCAGAATGG + Intergenic
1202749180 3_GL000221v1_random:140908-140930 TAAAAAGAAAAGAAGGAGGTTGG + Intergenic
969000400 4:3976172-3976194 GAAAATGCAGGGAAGGTGGTTGG - Intergenic
969952782 4:10854737-10854759 GAGAACGAAGAAAAGCAGGGTGG - Intergenic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
972632318 4:40853151-40853173 GGGCATGAAGAGAAGCAGGTGGG - Intronic
972681155 4:41308228-41308250 CAAAATGAAGATTGGCAGGTAGG + Intergenic
972696093 4:41448125-41448147 GAAAATGCAGAGTAGAATGTAGG + Intronic
972798591 4:42448379-42448401 GAAAAGAAAGAGAAGGAGGGAGG - Intronic
972945049 4:44243789-44243811 GAAAAGGAAGAGAAGGAGAATGG + Intronic
972966692 4:44519155-44519177 GGAAATGAAGAGGATTAGGTTGG - Intergenic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974340175 4:60604198-60604220 GAGAATGAAGAAAAGCAGGATGG - Intergenic
974439748 4:61900651-61900673 GAAAAGGAAGACCAGTAGGTGGG + Intronic
974970411 4:68818269-68818291 GAAAAAGATGGGAAGTAGGTGGG + Intronic
975109502 4:70607960-70607982 GAAGGTGAAGAGAAGGGGGTAGG - Intergenic
975647432 4:76558976-76558998 GAAAATGGAGAGGAGAACGTTGG - Intronic
975822205 4:78283039-78283061 AAAAATGAAAAGAAGCAAGGGGG - Intronic
977129229 4:93213198-93213220 CAACAGGAAGAGAAGCAGGATGG - Intronic
977532318 4:98214923-98214945 GAAAATGAAGGAAAGAAGATAGG + Intergenic
977599077 4:98916298-98916320 AAAAAGGAAGAGAAGGAGGATGG + Intronic
977654041 4:99501795-99501817 GAAAAAGAGGAGAAGCATTTAGG + Intergenic
977845167 4:101759436-101759458 GAAATTGAATAGAAACAGATGGG + Intronic
978188852 4:105890279-105890301 GAAAATGAAAAGGAGGAGATAGG - Intronic
978234577 4:106443269-106443291 GAAAGAGAAGAGAAGGAGGGAGG - Intergenic
978350339 4:107814476-107814498 GAGAATGAAGACTATCAGGTTGG + Intergenic
978648551 4:110972071-110972093 GAAAAGGAAGAGCAGGATGTAGG - Intergenic
979005768 4:115295276-115295298 GAAAATGGTGAGAAGCAGAAAGG + Intergenic
979155300 4:117379834-117379856 AAAAATGAGGAGAAGCTGATAGG + Intergenic
979403910 4:120285379-120285401 GAGCATGGAGAGAAGCAGGGAGG + Intergenic
979465446 4:121032484-121032506 GAACAGGGAGAGAAGTAGGTAGG - Intergenic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
980176913 4:129356990-129357012 CAAAATTAACAGGAGCAGGTGGG - Intergenic
980561778 4:134486747-134486769 GCAAAAGAAAAGAAGCAGATAGG - Intergenic
980850184 4:138372216-138372238 GAAAAGGAAGACAAGAAGGAAGG + Intergenic
981072354 4:140557121-140557143 GCAAATGGAGGGAAGCAAGTTGG - Intergenic
981122763 4:141071490-141071512 GAAAATAAAAACAAGCAGGGAGG + Intronic
982115273 4:152093825-152093847 GAAGAGGCTGAGAAGCAGGTTGG + Intergenic
982350773 4:154412982-154413004 GAAAAGGAAGAGGAGGAGGAAGG + Intronic
982529422 4:156520635-156520657 GAAAACAAAGAGGAGCAGGATGG + Intergenic
983549109 4:168996281-168996303 GAAAATGAAGAGAGGCTCTTTGG - Intronic
983870701 4:172822190-172822212 CAAACTGAAGAAAAGCAGGGAGG - Intronic
983880267 4:172924596-172924618 GAAAGGGAAGAGGAGAAGGTGGG + Intronic
984000243 4:174232586-174232608 GAAAATGAAAAGAAGAAGAGAGG - Intergenic
984090101 4:175362739-175362761 AAAAATGAAGAGAAGCTGGGAGG + Intergenic
984166977 4:176314361-176314383 CAAAAGGAAGAGAAGCTGCTTGG + Intergenic
985238069 4:187898550-187898572 GGAAAGGAAGAAAAGCAGGAAGG + Intergenic
985351421 4:189066951-189066973 AAAAATGAAAAGAAGAAGTTGGG - Intergenic
985355606 4:189116131-189116153 GAAAATGGTGAGAAGGAGGCAGG + Intergenic
1202752613 4_GL000008v2_random:22529-22551 TAAAAAGAAAAGAAGGAGGTTGG - Intergenic
986009667 5:3700806-3700828 GAGAAGGAAGAGAAGAAGGAGGG - Intergenic
986849364 5:11793241-11793263 GAAAATGGAGAGGAGCAAGTAGG - Intronic
986881847 5:12183925-12183947 GGGAATGAAGAGAAGCAGGCAGG + Intergenic
986958557 5:13186690-13186712 GAAAATGCAAACAAGCAGGCAGG - Intergenic
987144739 5:14981236-14981258 TAAAATGAACAGAAGTAGGAAGG - Intergenic
987229383 5:15877469-15877491 GAGACTGAAGAGATGCAGTTGGG + Intronic
987260094 5:16194891-16194913 AAGAATGAAGAAAAGCAGGGTGG + Intergenic
987332559 5:16869955-16869977 GAAAAGGAAAGGAAGCAGGCAGG + Intronic
987376833 5:17243458-17243480 GAAACTGAAGTTAAGAAGGTTGG - Intronic
987416197 5:17663995-17664017 GAGAATGAAGAAAAGCAGGATGG - Intergenic
987686642 5:21212890-21212912 GAGAAAGAAGAGATGAAGGTAGG + Intergenic
988173879 5:27695098-27695120 GAAAATGAAGATAAATAGCTGGG + Intergenic
988252632 5:28780124-28780146 GAAAAGAAAGAGAAGAAGGAAGG - Intergenic
989300083 5:39880891-39880913 GAAAATGCAGAGAAGCCTGGTGG - Intergenic
989351996 5:40497178-40497200 GAAATTAAAGAGAAGAAGTTGGG + Intergenic
989657524 5:43760454-43760476 GAAAATGAAGAAAAGCAGGATGG - Intergenic
990193602 5:53288980-53289002 GAAAATGAACACAAGCCAGTGGG - Intergenic
990338433 5:54798228-54798250 GAAAATGAACAGAACAAAGTTGG + Intergenic
990349471 5:54901257-54901279 GGAAAGGAAGAGAAGCAGGAAGG - Intergenic
990537286 5:56735211-56735233 CAAAATGAACAGAAGCATATTGG - Intergenic
990666780 5:58081445-58081467 GAAAAAGAAGAAATGCACGTGGG + Intergenic
991246879 5:64518010-64518032 GAAAATGCAAGGAAGCAGGAAGG + Intronic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
991709369 5:69392702-69392724 GAGAAAGAAAAGAATCAGGTGGG - Intronic
991715479 5:69447399-69447421 GAAAAAGAAGAAAAGAAGGAAGG + Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
992412984 5:76525509-76525531 GGAAAAGAAGAGAACCAGGGAGG + Intronic
992953739 5:81886998-81887020 GTAAATTAAGAAAAGCAGGCCGG - Intergenic
993119058 5:83753414-83753436 GAGGGTGAGGAGAAGCAGGTTGG + Intergenic
993262913 5:85683517-85683539 GAAAAAGAAGAAAAGAAGATAGG - Intergenic
993376099 5:87150634-87150656 GAAAATGGAGAAAAGCAGGGTGG - Intergenic
993505374 5:88702535-88702557 CAAAAGGAGGAGGAGCAGGTTGG - Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
993913822 5:93717282-93717304 GAAAATGCTGAGAATGAGGTAGG + Intronic
994628560 5:102252133-102252155 GAAAAGGAAGGGAAGAAGGGAGG + Intronic
994955056 5:106518995-106519017 GGAATTGAATAGAATCAGGTTGG - Intergenic
995082623 5:108071561-108071583 GAACAGGAGGAGAAGGAGGTGGG - Intronic
995358844 5:111270293-111270315 GAAAAGGAAGAGTAGCAGATAGG - Intronic
995930332 5:117434200-117434222 TAAAATAAAGAGAACCAGCTTGG - Intergenic
996156319 5:120107175-120107197 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
996867074 5:128136978-128137000 AGAAATTAAGAGGAGCAGGTAGG - Intronic
997029588 5:130110361-130110383 TAAAATGAAGAAAATCAGGTGGG - Intronic
997507441 5:134429032-134429054 GAAAATGACAAAAGGCAGGTAGG + Intergenic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
998666436 5:144303706-144303728 GGAAATGAGGAGATCCAGGTTGG + Intronic
998742352 5:145218529-145218551 TAAAATGAAGTGAAAAAGGTAGG - Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999234773 5:150083856-150083878 GCAAAAGAAAAGCAGCAGGTAGG - Intronic
999385213 5:151149351-151149373 GAAGTATAAGAGAAGCAGGTAGG + Intronic
1000209802 5:159098595-159098617 GAAAATGGAGAGAGGAAGGGAGG + Intronic
1000244648 5:159439315-159439337 GAGAAGGAATAGCAGCAGGTAGG + Intergenic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1000500103 5:162037206-162037228 GAACATGGAGAGAAGGAGATGGG + Intergenic
1000508769 5:162155673-162155695 AAAAATTAAGAGAGGCATGTGGG + Intergenic
1000812151 5:165876725-165876747 GTAAATGGAGAGAACCAGGAAGG + Intergenic
1000864473 5:166495676-166495698 GAAAAGGAAGAGGAGCACATGGG - Intergenic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1001423417 5:171604835-171604857 GAAAAAGAAGAGCAGGAGGCTGG - Intergenic
1001601557 5:172932288-172932310 GAAGATGAAGAGCAGTTGGTTGG + Intronic
1001769892 5:174286371-174286393 CAAAATTAAGAAAATCAGGTTGG + Intergenic
1001812934 5:174643761-174643783 GAAAAAGAAAAGAAGCAGACTGG + Intergenic
1001855550 5:175007545-175007567 GAAAAGGGAGGGAAGAAGGTAGG - Intergenic
1002112364 5:176926771-176926793 GAAAAAGAAGAGAAATAGGAGGG + Intronic
1002404852 5:179022294-179022316 GAATATGAAGAGAAAAAGGGAGG + Intergenic
1002895041 6:1373832-1373854 GAGAATGAAGAGTATCAGGTAGG - Intergenic
1002903878 6:1433333-1433355 GAAAATGAAATGAAGCAAGAAGG - Intergenic
1002950465 6:1805056-1805078 AAAAATGAAATAAAGCAGGTGGG - Intronic
1002967059 6:1977609-1977631 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1003167841 6:3696905-3696927 GAGATGGAAGAGAAGCAGGAAGG + Intergenic
1003666420 6:8115849-8115871 GAAAAACAAGAGAAGAAGCTCGG + Intergenic
1003725749 6:8761213-8761235 GAAGAAGAAGAGAAACAGGAAGG - Intergenic
1004330238 6:14714475-14714497 GAAAAGGAAGAGAGGAAGGAAGG - Intergenic
1005565028 6:27082894-27082916 GAAAATGGAGACATTCAGGTTGG + Intergenic
1005804872 6:29464894-29464916 TAAAATGGAGTGAAGAAGGTAGG - Intergenic
1007330657 6:41104940-41104962 GAAAATGAAAAGAAGGAAGAAGG + Intergenic
1007400030 6:41598161-41598183 GAAAATGGGGAGGAGAAGGTGGG - Intronic
1007925714 6:45647860-45647882 TAAAAAGAAGAGATGTAGGTGGG + Intronic
1008048328 6:46874209-46874231 TAAAGAGAAGAGAAGCAGATTGG - Intronic
1008660008 6:53657796-53657818 GCAGAAGAAGAGTAGCAGGTAGG + Intronic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1009435436 6:63612928-63612950 GAGAGTGAAGAGAAAAAGGTGGG - Intergenic
1009777420 6:68222567-68222589 GAAGAAGAAGGGAAGGAGGTAGG + Intergenic
1010026790 6:71227973-71227995 TGAAATGAAGAGAAACAGGCAGG - Intergenic
1010169100 6:72953834-72953856 GAAAATGAAGAGAGGCAGTATGG + Intronic
1010506962 6:76672461-76672483 GAATAAGAAAAGTAGCAGGTAGG - Intergenic
1010573108 6:77502019-77502041 GAAAATGAAGAGAGGAAAGCAGG - Intergenic
1010800407 6:80168429-80168451 GAAAAGGAAGAGAGGGAGGGAGG + Intronic
1012189993 6:96267180-96267202 GAAAATGAAGAGGAGATGGTGGG + Intergenic
1012230121 6:96751189-96751211 AAGAAGGAAGAGAAGAAGGTAGG + Intergenic
1012373797 6:98537298-98537320 GAAAATGAAGGAAAGAAGGAAGG + Intergenic
1012560545 6:100575077-100575099 GAAGATAAAGAGTAGCAGATGGG + Intronic
1012572258 6:100743225-100743247 GATAATGAAGAAAAGCAGGGTGG - Intronic
1013308325 6:108870609-108870631 GAAAAAGAAGAGAGGGAGGGAGG + Intronic
1013469183 6:110446103-110446125 CTAAATGCAGAGCAGCAGGTTGG - Intronic
1013787617 6:113799282-113799304 CAAAATGAAGAGTAGGTGGTGGG - Intergenic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014242917 6:119038061-119038083 GAAACACAAGAGGAGCAGGTGGG + Intronic
1014564487 6:122930919-122930941 GAGAACAAAGAAAAGCAGGTGGG - Intergenic
1014999906 6:128202186-128202208 GAAAATGAAGAAAAGCAGGGTGG + Intronic
1015047952 6:128800817-128800839 GAGGAAGAAGAGAAGCAGGGGGG - Intergenic
1015048883 6:128814706-128814728 GAAAAAGAAAAAAAGCATGTAGG - Intergenic
1015076327 6:129162873-129162895 GAGAATGAAGAGAACTAGGAGGG + Intronic
1015417288 6:132963764-132963786 GAAAATGGAGATAAGTAGGTAGG - Intergenic
1015686033 6:135861884-135861906 GAAATTGAAGAGATGCCAGTTGG - Intronic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016423928 6:143913830-143913852 GAGAATGAAGAAAAGTAGGGTGG - Intronic
1016658180 6:146544174-146544196 GAAAAAGAAAAGAAGCAGAGAGG - Intronic
1016869603 6:148803737-148803759 GAGAAGCAAGAGGAGCAGGTAGG - Intronic
1017030210 6:150214436-150214458 GGAAAAGAAGAGAAGGAGGAGGG - Intronic
1017112917 6:150949512-150949534 GGAAGTGAACAGAAGAAGGTGGG - Intronic
1017187371 6:151615662-151615684 GAAAAGAGAGAAAAGCAGGTGGG + Exonic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017806932 6:157954184-157954206 GAAAAGGAAGTGGAGCAGGCGGG + Intergenic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018042240 6:159934953-159934975 GAAAAAGAAGAGGAGGAGGGGGG + Intergenic
1018352525 6:162975773-162975795 GAAAAGGGAGAGAAGAAGGGAGG - Intronic
1018389566 6:163331852-163331874 GCAAATGAAGGGAAGCACGTGGG + Intergenic
1018475638 6:164138162-164138184 AGGAATGCAGAGAAGCAGGTGGG - Intergenic
1018658881 6:166066967-166066989 TAGAATGAGAAGAAGCAGGTAGG - Intergenic
1018861649 6:167714398-167714420 GAAAAGGAAGGAAAGCAGGAAGG + Intergenic
1018979553 6:168592191-168592213 GAAGATTGAGAGAAGCAGGATGG - Intronic
1019550861 7:1601920-1601942 GCAGATGAAGAGAAGCAGGGTGG + Intergenic
1019690542 7:2408536-2408558 TAAAATGAAAAGAAGCAGAAGGG + Intronic
1019978982 7:4606997-4607019 GAAAATAAAGAGAGGCTGGCTGG - Intergenic
1020368861 7:7411489-7411511 GAAAAAGAGGAGTAGCAGTTAGG - Intronic
1021279105 7:18694903-18694925 GAAAATGAGGAGTAGGAGGGAGG - Intronic
1021342581 7:19482656-19482678 TAAAATAAAGAGAAGCCAGTAGG - Intergenic
1022214997 7:28250406-28250428 AAAAATGAAGAGATGGGGGTCGG - Intergenic
1022671561 7:32460882-32460904 GAAATTGAAGAGAGTCAGGCCGG + Intergenic
1023196281 7:37642578-37642600 GAGAGTGAGGAAAAGCAGGTGGG - Intergenic
1023447221 7:40244338-40244360 ACAAATGCAGAGAAGCAGGAAGG + Intronic
1024737719 7:52323454-52323476 GAAAAAGAAGGGAAGCAGGAAGG - Intergenic
1024805257 7:53132004-53132026 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025617284 7:63131952-63131974 TAAAAGGAAGACAAGAAGGTAGG + Intergenic
1025879348 7:65520015-65520037 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025885147 7:65582916-65582938 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1026133153 7:67636824-67636846 GAAAAAGAAGAGAGGGAGGAAGG - Intergenic
1026245429 7:68615341-68615363 GAAGATGAGGAGAAGAAGGAGGG + Intergenic
1026462654 7:70628772-70628794 GAAACTGAAGACAAGCAGTTGGG + Intronic
1026499681 7:70933650-70933672 GAAAATGAAGAGTGGCAAGAAGG + Intergenic
1026690303 7:72545166-72545188 GAAAAGGAAGAGAGGGAGGGAGG + Intergenic
1027176423 7:75906643-75906665 GACAATGAAGAGAGCCAGGCGGG + Intronic
1027176563 7:75907614-75907636 GACAATGAAGAGAGCCAGGTGGG + Intronic
1028636891 7:92998859-92998881 GAAGATAAAGATAAGCAGGAAGG - Intergenic
1029478456 7:100799201-100799223 GAAAAGGAAGGGAAGGAGGGAGG - Intergenic
1029563271 7:101318221-101318243 GAAAAAGAAGAGCAGTAGGCTGG + Intronic
1030728934 7:112961322-112961344 TAAAATGATCAAAAGCAGGTAGG - Intergenic
1030983246 7:116210717-116210739 GAAAACAAAGTGAAGAAGGTAGG + Exonic
1031264239 7:119564389-119564411 GAAGATGATGAGTAGCAGGCAGG + Intergenic
1031328952 7:120438815-120438837 GAAAATGAAAAGAAACAAGCTGG - Intronic
1031634673 7:124087330-124087352 GAAAAAGTAGAGAAGCAAATAGG - Intergenic
1031777947 7:125924164-125924186 GTAAATGAAGAGAAACCTGTAGG - Intergenic
1031873350 7:127110970-127110992 GAATATGGAGAGAAGAGGGTGGG - Intronic
1032014965 7:128373348-128373370 GAAAAAGAAGAGTAGCAAGTGGG + Intergenic
1032380194 7:131471349-131471371 GAAAATGAAGAGAGGTTGGTGGG + Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032626323 7:133595152-133595174 GGAAAGGAAGAGAAGGAGGATGG + Intronic
1032871550 7:135991384-135991406 GCAAGAGAAAAGAAGCAGGTAGG + Intergenic
1033254954 7:139792429-139792451 GAGAATAAAGACAAGTAGGTAGG - Intronic
1033589909 7:142800699-142800721 TAAAATGGTGAGAAGTAGGTAGG + Intergenic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1033977337 7:147117436-147117458 GAGAATGAAGGAAAGCAGGATGG - Intronic
1034295819 7:149971595-149971617 GTATATAAACAGAAGCAGGTAGG + Intergenic
1034476906 7:151290274-151290296 GGAAATGTAGAGAAGCAGTGAGG - Intergenic
1034810233 7:154125309-154125331 GTATATAAACAGAAGCAGGTAGG - Intronic
1034889768 7:154829512-154829534 GAAAATGGAGAGAGGGAGGAAGG + Intronic
1034966252 7:155393005-155393027 GAACAGGAAGAGATGCAGGTTGG - Intronic
1035063549 7:156088850-156088872 GAAAATGAAGAGACAGAGGAGGG + Intergenic
1035255735 7:157625885-157625907 GAAAATGAAGATAAGCAGAATGG + Intronic
1035901267 8:3460602-3460624 GAGAATGAAGATAAACAGGAGGG + Intronic
1037583763 8:20262318-20262340 CAAAATGTAGAGGATCAGGTGGG + Intronic
1038050674 8:23807576-23807598 GAAAGCAAAGAGAAGCAGGAAGG + Intergenic
1038387153 8:27159387-27159409 CAAAATAAAGAGAAGCCTGTGGG - Intergenic
1038686277 8:29721581-29721603 GAAATTGAAGAGCAGGAGGAAGG + Intergenic
1039448410 8:37650816-37650838 GAAAATTAAGAGTAGCATGGAGG + Intergenic
1039820407 8:41129567-41129589 GAGAATGAAGAAAAGCAGGTGGG + Intergenic
1039852599 8:41383106-41383128 GAAAATGAATACCAGGAGGTGGG + Intergenic
1041716646 8:60938529-60938551 GAAAATGAAGAGGAGGAGATTGG - Intergenic
1041897763 8:62946065-62946087 GAAATTGAAGAGAAGCACATGGG - Intronic
1042487630 8:69363913-69363935 GAGAAGGAAGAGGAGCAGGGAGG + Intergenic
1043014177 8:74917902-74917924 GAAAAAGAAGAGAGGGAGGGAGG + Intergenic
1043035660 8:75195133-75195155 GAAAAAAAAGAAAAACAGGTAGG + Intergenic
1043363281 8:79500163-79500185 GAGAATGAAGAAAAGCGGGGGGG - Intergenic
1043624482 8:82239162-82239184 GAAAATGAAAAACAGCATGTTGG + Intergenic
1043830495 8:84982765-84982787 GAAATTAAAGAGAGGGAGGTTGG + Intergenic
1043920332 8:85975313-85975335 GAAAGTGAACAGAAGAAAGTTGG - Intergenic
1043948764 8:86284278-86284300 GAAAATGAACAGAAGAAAGTGGG + Intronic
1043985301 8:86688094-86688116 GAAAATGAACAGAAGCGTGAGGG + Intronic
1044018462 8:87074720-87074742 GAGAATGAAGAAAAGCAGGGTGG - Intronic
1044113234 8:88302861-88302883 GAGAATGAAGAAAAGCAGGGAGG + Intronic
1044447682 8:92297463-92297485 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1044485536 8:92748700-92748722 CAAAATGGAGAGAGACAGGTAGG + Intergenic
1044557183 8:93575976-93575998 GAAGATGAATAGAAGGAGTTAGG + Intergenic
1045083998 8:98660804-98660826 GAAAGTGAAGAGAAGAGGGAAGG - Intronic
1045153284 8:99434710-99434732 GAAAATTAAGAGAAGAATGGGGG + Intronic
1045733069 8:105263949-105263971 GAGAATGGAGAAAAGCAGGGTGG - Intronic
1046042099 8:108917975-108917997 GGAAAAGAAAAGAAGCAAGTTGG + Intergenic
1046552565 8:115734900-115734922 GGAAAGAAAGAGAATCAGGTAGG - Intronic
1046906843 8:119582608-119582630 GAAAATTAAGAAAAGGAGGCAGG + Intronic
1047108334 8:121759988-121760010 GAAAAAGAAAAGAACCAGCTTGG - Intergenic
1047261309 8:123263004-123263026 GAGAAGGAAGAGAAGCGGGAAGG + Intronic
1047585207 8:126264242-126264264 GAAAATGACAAGAATCATGTAGG + Intergenic
1048131349 8:131701151-131701173 GAAAATTAAAGGAAGCAGTTTGG + Intergenic
1048376817 8:133830043-133830065 GAAAAAGAAAAGAAGTAGGCGGG - Intergenic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1048457055 8:134587737-134587759 GGGAATGGAGAGAAGAAGGTAGG - Intronic
1048497601 8:134948059-134948081 GAAAAGTAACAGAAGCAAGTGGG - Intergenic
1048630847 8:136240723-136240745 GAAAATGAGCAGAAGCTGGCTGG - Intergenic
1048675934 8:136780047-136780069 GAAAATGATGAGAAATAAGTGGG - Intergenic
1049297110 8:141847375-141847397 GAAAGTGAAGAGAAGACGGGTGG + Intergenic
1049374391 8:142282050-142282072 GAAAAGGAAGTGAAGCAGCAGGG - Intronic
1049891067 9:71888-71910 GAAAATGAAAAGGAGAGGGTTGG + Intergenic
1050282012 9:4060339-4060361 GAAGGTGACGAGAAGCAGGCTGG - Intronic
1050295831 9:4204552-4204574 AAAAATGCAGAGAACCAGGGAGG + Intronic
1050369467 9:4905802-4905824 GAAAATGGAGAGAAATATGTTGG + Intergenic
1050713413 9:8492112-8492134 GAAAAAGAAGAAAAGCAAGAAGG - Intronic
1051099323 9:13502898-13502920 GGAAAGGGAGAGAAGCAGGATGG - Intergenic
1051254370 9:15197578-15197600 GAAAATGAAGGGAAAAAAGTAGG + Intronic
1051628052 9:19117113-19117135 AAAAAGGAAGGGAAGCAGGGAGG - Intronic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052002693 9:23306095-23306117 AAAAATAAAGAGAAGCACTTGGG - Intergenic
1052174580 9:25442777-25442799 AAAAATGAAGAAAAGTAGGAGGG - Intergenic
1052176884 9:25473007-25473029 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053102553 9:35383004-35383026 GATAAAGAAGAGAAGGTGGTTGG + Intronic
1053161005 9:35813440-35813462 GAAGAAGAAGACCAGCAGGTGGG - Exonic
1053185402 9:36012150-36012172 GAGAATGAAGAGAAGACGGGAGG + Intergenic
1053430828 9:38040756-38040778 CAAAATGAAGAAAAGGAGTTTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053732508 9:41072943-41072965 GAAAATGAAAAGGAGAGGGTTGG + Intergenic
1054695923 9:68358632-68358654 GAAAATGAAAAGGAGAGGGTTGG - Intronic
1054903489 9:70393527-70393549 GAAGATGAGAAGAACCAGGTAGG - Intronic
1055084992 9:72304926-72304948 GAAAAGGAAGAGAGGGAGGCTGG - Intergenic
1055179808 9:73371697-73371719 GAAAATGAAGTGAAGCTTGAAGG - Intergenic
1055849243 9:80605762-80605784 AAAAATGAAAAGGAGGAGGTTGG - Intergenic
1055956258 9:81776376-81776398 GAAAAGGAAGAGAAGGAAGCAGG + Intergenic
1056009045 9:82306206-82306228 GAAAATGAAGATAAACAGCAGGG - Intergenic
1056482374 9:87018612-87018634 GAAAAGCAAGAGAAGCAGGAAGG - Intergenic
1056484262 9:87039070-87039092 TAAAATGAAGGGTGGCAGGTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056847374 9:90052421-90052443 AAAAGTGAAGAGAAGAAGGCAGG - Intergenic
1057057124 9:91972174-91972196 GAGAATGAAAAAAAGCAGGGCGG + Intergenic
1057376544 9:94529100-94529122 GAAAGTGAACAGAACCAGATGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058067027 9:100560650-100560672 GAAAATGAAGAGAGTCAGGAAGG - Intronic
1058200266 9:102029231-102029253 GAGAACGAAGAAAAGCAGGATGG - Intergenic
1059076217 9:111196695-111196717 GAGAATGAAGAAAAGCCGGGGGG + Intergenic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059510111 9:114837039-114837061 GAGAATGAAGAAAACCAGGGTGG - Intergenic
1059683052 9:116605095-116605117 GAAAAAGAAGAAAAGAAGGAAGG + Intronic
1059859665 9:118445226-118445248 GGAAATGAATAGTAACAGGTAGG - Intergenic
1059881447 9:118694704-118694726 GAAAATGCAGACAATCATGTTGG + Intergenic
1059972879 9:119685670-119685692 GAAAATGAAGGAAAGAAGGACGG - Intergenic
1060702635 9:125771758-125771780 GGAAAGGAAGAAAAGTAGGTAGG - Intronic
1061541570 9:131280305-131280327 GAAAATGACGAGCAGGAGGAAGG - Intergenic
1061886166 9:133592033-133592055 GAAAATGAAAACAAGCAGGGTGG - Intergenic
1203717816 Un_KI270742v1:170998-171020 TAAAAAGAAAAGAAGAAGGTTGG + Intergenic
1203533402 Un_KI270743v1:7232-7254 TAAAAAGAAAAGAAGGAGGTTGG - Intergenic
1203581732 Un_KI270746v1:13098-13120 GAAAATAAAGAGGAGAAGGACGG + Intergenic
1185861545 X:3583975-3583997 GAAAAAGAAGAGAAACAGGAAGG + Intergenic
1185867570 X:3637147-3637169 GAAAAAGAAAAGAAGGAGGAAGG + Intronic
1185922914 X:4114099-4114121 GAAAGTGGGGAGAACCAGGTTGG - Intergenic
1186047823 X:5555193-5555215 GAAAGTGAAGAGAAGTAGAAGGG - Intergenic
1186159859 X:6765784-6765806 GAAAAAGAAGAGAAAGAGGTTGG + Intergenic
1186261847 X:7788664-7788686 GAAAATATAGAGAAGCCTGTAGG + Intergenic
1186294012 X:8129104-8129126 GCAAGTGAAAGGAAGCAGGTTGG + Intergenic
1187047313 X:15660021-15660043 GCAACTAAAGAGAAGCAGGAAGG + Intronic
1187818092 X:23255639-23255661 GATAATGAAGAAAAGCAGGTGGG + Intergenic
1188051774 X:25496614-25496636 GGACATGAAGAGAACCAGGGTGG + Intergenic
1188186992 X:27128308-27128330 GGACATGAAGAGGAGCAGATCGG - Intergenic
1188205908 X:27358317-27358339 AAAGGTGAAGAGAAGAAGGTAGG + Intergenic
1188397234 X:29700400-29700422 CAAAATGAACTGAAGCAAGTGGG - Intronic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1189106480 X:38241047-38241069 GAAAACGTAGAGAAGCACATAGG - Intronic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1189705769 X:43757163-43757185 GAGAATGTGGACAAGCAGGTGGG - Intergenic
1189838266 X:45042467-45042489 AAAAATTAAGAGAAGCAAGATGG + Intronic
1189907223 X:45773813-45773835 CAAAATGAAGAGAGGGTGGTTGG + Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1190104989 X:47553534-47553556 AAAAATGAAGAGGAAGAGGTGGG - Intergenic
1190125776 X:47704106-47704128 GAAAATGAATAATATCAGGTAGG + Intergenic
1190803724 X:53814995-53815017 GAGAACGAAGAAAAGCAGGGTGG - Intergenic
1190856564 X:54300944-54300966 GAAACTAAAGGGAGGCAGGTTGG + Intronic
1191196831 X:57733084-57733106 GAACTTGGAAAGAAGCAGGTGGG - Intergenic
1191712277 X:64163051-64163073 GCAAGAGAAGAGGAGCAGGTAGG - Intergenic
1191749151 X:64522490-64522512 GTAAATGAATGGAAGGAGGTGGG - Intergenic
1191815744 X:65242147-65242169 GAGAATGAAAAAAAGCAGGGTGG - Intergenic
1191832576 X:65430853-65430875 GAGAATGAAGAAAAGCAGGATGG - Intronic
1191955437 X:66638663-66638685 GATAAAGAAGAGAAGGAGGCTGG - Intronic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192106008 X:68317648-68317670 GAAGAAGAAGAGAAGGAGGAAGG + Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192278791 X:69662106-69662128 GAAAATGGAGAGATGTATGTAGG - Intronic
1192292666 X:69814693-69814715 GAGAATGAAGAAAAGCAGGATGG + Intronic
1192855806 X:75010636-75010658 GAGAATGTAGAGAAAGAGGTAGG - Intergenic
1192897400 X:75458937-75458959 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193176387 X:78400084-78400106 GAGAAGGAAGAAAAGTAGGTTGG + Intergenic
1193462397 X:81806718-81806740 GAAAATGAATAGTAGTAGGATGG + Intergenic
1194150354 X:90317802-90317824 GCAATAGAAAAGAAGCAGGTAGG + Intergenic
1194223647 X:91227576-91227598 CAAAAGGTAGAGAAGCAAGTGGG + Intergenic
1194251241 X:91577718-91577740 TAAAATGATAAGAAGAAGGTCGG + Intergenic
1194445071 X:93976526-93976548 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1194771145 X:97907384-97907406 GAACATGAAGAAAAACAGGCTGG + Intergenic
1194853555 X:98899788-98899810 TAAAATGAAAAGAAAAAGGTAGG + Intergenic
1195408560 X:104544052-104544074 GGAGATGGAGAGAAGTAGGTAGG - Intergenic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195750379 X:108157885-108157907 TAAAGTGAAGAGAAACAGGCAGG - Intronic
1195830290 X:109050145-109050167 GAAAACAAAAAGAAGCAAGTAGG + Intergenic
1196010013 X:110876712-110876734 GTACATGAAAGGAAGCAGGTAGG + Intergenic
1196537891 X:116868582-116868604 GAAAATGAAGAAAAGCAGGGTGG - Intergenic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1196712355 X:118776046-118776068 AAAAATGGAGAGAAGTAGGAAGG + Intronic
1196820604 X:119697425-119697447 GAAAAGAAAGAGAAGAAAGTTGG + Intergenic
1197023284 X:121716808-121716830 GAAGGTGAAGAGAAGCAGAGTGG - Intergenic
1197023730 X:121721583-121721605 CAAAATGAAGAGCAGCAGAAAGG - Intergenic
1197180767 X:123533661-123533683 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1197367822 X:125587166-125587188 GAAAAAGAAGGAAAGAAGGTAGG + Intergenic
1197455102 X:126669988-126670010 GAAAACAAAGAAAAGCAGGATGG + Intergenic
1197565905 X:128085670-128085692 GCAAGAGAAAAGAAGCAGGTAGG + Intergenic
1198727357 X:139691815-139691837 GAAAATAAAGAAAAGCCGGCCGG + Intronic
1198753376 X:139957750-139957772 GAAAATGAAGAGAAAGAGAGAGG - Intronic
1199107275 X:143884807-143884829 GGAAATGAATAAAAGCAGGGAGG - Intergenic
1199401537 X:147405126-147405148 GATAACGAACAGAAGCAGGGTGG + Intergenic
1199986747 X:152958289-152958311 GAAGGGGAAGAGAAGCAGCTGGG + Intronic
1200344456 X:155435092-155435114 GAGCATGAAGATAAGCAGGGTGG + Intergenic
1200496717 Y:3894559-3894581 GCAATAGAAAAGAAGCAGGTAGG + Intergenic
1200560113 Y:4690958-4690980 CAAAAGGTAGAGAAGCAAGTGGG + Intergenic
1200570182 Y:4818950-4818972 TAAAATGATAAGAAGAAGGTCGG + Intergenic
1201300294 Y:12498890-12498912 GAAAAGGAGGAGGAGGAGGTGGG - Intergenic