ID: 951587777

View in Genome Browser
Species Human (GRCh38)
Location 3:24232876-24232898
Sequence GGATGCAGATAGGTTAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951587777 Original CRISPR GGATGCAGATAGGTTAAGAT TGG Intronic
901839271 1:11943787-11943809 GCATGCATTTAGGTTAAGAGAGG + Intronic
903861000 1:26364520-26364542 GGAGGCAGATACCTTGAGATTGG + Exonic
905438782 1:37979477-37979499 GAATGCAGAGAGGTCAAGATGGG + Exonic
906154281 1:43605063-43605085 GGATGCACATGGGTTAGGACTGG - Intronic
908685769 1:66717691-66717713 GTATGCATAAAGTTTAAGATTGG - Intronic
908922541 1:69212804-69212826 GAAGGCAGATGGGTTAAGAGGGG + Intergenic
909327835 1:74374693-74374715 GCATGCAGATAGGTTTTGTTTGG + Intronic
909629562 1:77757705-77757727 GAATTCAGATAGATTAAGATTGG - Intronic
909704035 1:78559783-78559805 TGATGCAGATAGTTTAAAACTGG - Intergenic
914509836 1:148321728-148321750 GGAGGCATATAGGTCATGATTGG + Intergenic
916064631 1:161126206-161126228 GGATTTAGGTAGGTTAAGATTGG - Intronic
916477795 1:165186387-165186409 GGGTGCAGCTAGGCTCAGATTGG - Intergenic
918283280 1:183026011-183026033 GGAGGCAGATATGTTAACTTTGG + Intronic
1065612905 10:27490012-27490034 AGATGCCAACAGGTTAAGATAGG - Intergenic
1068034108 10:51738583-51738605 GGAGGTAGATAGGTTATGAGAGG + Intronic
1080605656 11:33862770-33862792 GGCAGCAGAGAGCTTAAGATGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1087331505 11:96786806-96786828 GGATGCAGATATGTTTAGGATGG + Intergenic
1090079033 11:123598706-123598728 GAATGCAGAGAGGTCAAGATGGG + Intronic
1092905421 12:13096566-13096588 AGATGCAGATAGAATAGGATTGG + Intronic
1096496521 12:52042241-52042263 GGAAGCAGATAGGGTAGAATAGG + Intronic
1097174488 12:57135011-57135033 GGATGCAGCCGGGTTAAGAAAGG - Intronic
1099653376 12:85457537-85457559 GGCTGCAGAGTGGTTAAGGTAGG - Intergenic
1099913294 12:88860215-88860237 AGATGCAGACAGGTTTATATGGG + Intergenic
1101339176 12:103826317-103826339 GGTTGCAGATGGATTAAGATTGG + Intronic
1102545854 12:113654926-113654948 GGATGCAGCTAGTTTAAGCATGG + Intergenic
1104165823 12:126228945-126228967 GTATGCAGAGAGTTTAAAATAGG + Intergenic
1109219894 13:59630486-59630508 GGATGCAGAGAAGTTAAGTGAGG - Intergenic
1111625087 13:90774678-90774700 GGATTAGCATAGGTTAAGATGGG + Intergenic
1113602784 13:111582597-111582619 GGCTGCAGAAAGGATGAGATGGG - Intergenic
1113661684 13:112111514-112111536 GGATGGAGATAGCTCAAGAGAGG + Intergenic
1113692047 13:112318017-112318039 GGATGCAGCCAGGTAAACATGGG + Intergenic
1116124013 14:40758245-40758267 GGATGCAGTTCGGTTAGGCTTGG + Intergenic
1116189676 14:41648013-41648035 AGATGTAGATATGTTAATATAGG - Intronic
1117048851 14:51840548-51840570 AGATGCAGAGAGTTTGAGATTGG - Intronic
1117419556 14:55530836-55530858 GGATGCAGAGAGCTTGAGAAGGG + Intergenic
1121382668 14:93487693-93487715 TGATGCAGAGAGGTTAACATGGG - Exonic
1122046541 14:99028077-99028099 GGAGTCAGATAGGCTAAGACAGG - Intergenic
1125814119 15:42569367-42569389 GGCTGCAGTGAGGTCAAGATTGG - Exonic
1126807749 15:52369183-52369205 AGATGCAGGTCGGTTAGGATAGG - Intronic
1127942413 15:63712489-63712511 ACTTGTAGATAGGTTAAGATTGG + Intronic
1129497778 15:76002613-76002635 AGATACAGATAGGTTAAAAGAGG + Intronic
1131597166 15:93809856-93809878 AGATGCTGAGAGGTTAACATTGG - Intergenic
1133999807 16:10774069-10774091 GGAACCAGATAGATGAAGATGGG - Exonic
1136106023 16:28030939-28030961 GTATTGAGATGGGTTAAGATGGG + Intronic
1137517620 16:49161750-49161772 GGATTCAGATAGGAAAAGATAGG - Intergenic
1138874038 16:60927706-60927728 GGATGCATATAGGGTATGACAGG + Intergenic
1139173358 16:64658059-64658081 GCATGCAGAAAGATTATGATAGG + Intergenic
1140314367 16:73880246-73880268 GCAGGCAGAGAGGTTTAGATGGG + Intergenic
1141206523 16:81937177-81937199 GGATGCAAATAGGTGGAGGTTGG + Intronic
1143586382 17:7852711-7852733 GGATGGAGAGAGGTAAAAATGGG - Intronic
1145904596 17:28509263-28509285 GAATGGAGATAGGTTATGATGGG - Intronic
1145924670 17:28637321-28637343 GAATCTAGTTAGGTTAAGATGGG - Intronic
1150073695 17:62174165-62174187 GAATGTAGATAGGTAAAGGTTGG - Intergenic
1151168010 17:72221167-72221189 GGATGCAGACAGGTGCACATGGG + Intergenic
1151310316 17:73288719-73288741 GGATGCAGAGAGGTCAGGCTGGG - Intronic
1153613070 18:6907642-6907664 GGATGGAGATAGGGTAGGATGGG + Intronic
1154075410 18:11195765-11195787 GGAGGCAGATAGGGTATGTTGGG + Intergenic
1159887749 18:73925130-73925152 GTGTGCAAGTAGGTTAAGATAGG - Intergenic
925910173 2:8568786-8568808 GGATGCAGATTGGGAAAGTTTGG - Intergenic
927872429 2:26632050-26632072 GGATCCAGATAGATCCAGATAGG - Intronic
929029020 2:37633687-37633709 GGCAGCTGATAGGATAAGATTGG - Intergenic
931872464 2:66476154-66476176 AGATGCTGAGAGGCTAAGATGGG + Intronic
939369537 2:141280593-141280615 GGATGCAGAACGCTTAATATTGG + Intronic
940664942 2:156597337-156597359 GGATGCTGAAAAGTTAAAATTGG + Intronic
941349886 2:164419014-164419036 TGCTGCTGATAGGTCAAGATGGG - Intergenic
943898296 2:193397654-193397676 GGAAGAAGTTAGGGTAAGATGGG - Intergenic
943910246 2:193555372-193555394 GGATGATGATACATTAAGATAGG + Intergenic
945867397 2:215191556-215191578 GGAGCCAGAAAGGTCAAGATAGG + Intergenic
946943110 2:224790759-224790781 GTATGAATATAGGTGAAGATAGG - Intronic
947061202 2:226168195-226168217 GGATGAAGCAAGGATAAGATCGG - Intergenic
1170475919 20:16714406-16714428 GAATGCAGACAGGTTAAAATTGG - Intergenic
1174926612 20:54767169-54767191 GGATGCTGATATGTTCTGATGGG + Intergenic
1174970081 20:55265098-55265120 GCATGCAAATAGGTGAAGGTCGG + Intergenic
1175689744 20:61056834-61056856 GGCTGCAGAGAGTCTAAGATAGG - Intergenic
1179232379 21:39516629-39516651 GGATGGAGATAGATTTAGTTAGG + Intergenic
1182835353 22:33337432-33337454 GGATGCAGACAGGGTATGTTTGG - Intronic
1184860837 22:47172557-47172579 GGATTCTCATAGGTAAAGATAGG - Intronic
1185008972 22:48302574-48302596 GGATGCAAATATGTTGTGATTGG - Intergenic
949779417 3:7669322-7669344 GGAGGTAGCTAGGTAAAGATGGG + Intronic
951587777 3:24232876-24232898 GGATGCAGATAGGTTAAGATTGG + Intronic
954666400 3:52255345-52255367 GGTTGCAGATATGTGAAGTTAGG + Exonic
956798930 3:72739477-72739499 GGCTGCAGAGAGGTAAAGATGGG + Intergenic
959297282 3:104552926-104552948 GGATCCAGATAGGTTGATAAGGG + Intergenic
960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG + Intronic
960487687 3:118273040-118273062 GGAGGCAGATGTGCTAAGATGGG + Intergenic
961171355 3:124799948-124799970 GCCTGCAGATAGGATAAGAGTGG + Intronic
964735041 3:159908339-159908361 GGATGCAGAGGGGTTAAGAAGGG + Intergenic
970681089 4:18509187-18509209 GGAAGAAGATAGATTAAAATGGG + Intergenic
971412871 4:26393802-26393824 GGGTGCAGAGAGTTTAAAATTGG + Intronic
973080632 4:45987959-45987981 GGATGATGATAGGGAAAGATAGG + Intergenic
980730518 4:136818019-136818041 GGATGCATATAAGTTATGAAAGG + Intergenic
981534360 4:145783794-145783816 GGATGGAGAAAGGGAAAGATGGG + Intronic
987142259 5:14958300-14958322 GGATACAGATAGAATAGGATAGG - Intergenic
989609168 5:43274806-43274828 GGATACAGCTAGTTTAAAATAGG - Intronic
990702967 5:58495532-58495554 GGATTCAGAAAGGTGGAGATAGG - Exonic
993153875 5:84196894-84196916 GGATGCACATATACTAAGATTGG + Intronic
993843784 5:92914089-92914111 GGATGCAGAATGGTGAAGAGTGG + Intergenic
994980626 5:106871707-106871729 GGAAGCAGAAAGCTTAAAATTGG + Intergenic
995333986 5:110977540-110977562 GGCAACAGAGAGGTTAAGATAGG - Intergenic
997583215 5:135030165-135030187 GTAGGCAGATAGGTAAGGATGGG - Intronic
1000475395 5:161700418-161700440 GGATGCAGACAAGAAAAGATAGG + Intronic
1003163807 6:3658765-3658787 GCAGGCAGGAAGGTTAAGATGGG + Intergenic
1006354587 6:33547425-33547447 CGATGAAGGAAGGTTAAGATGGG - Intergenic
1010158348 6:72821971-72821993 GGATGCACGAAGGATAAGATAGG - Intronic
1010938685 6:81890034-81890056 GGATGAAGGAAGTTTAAGATGGG - Intergenic
1011083810 6:83516809-83516831 GGAGGCAGACGGGTTAAGAGTGG - Intronic
1015639494 6:135315865-135315887 GGATGCAGATAAGTTAATAAAGG - Intronic
1017257662 6:152352242-152352264 CGAGGCAGAGAGGTTAAGAAAGG - Exonic
1019275887 7:175372-175394 GGATGCAGAGAGGTTTGCATTGG + Intergenic
1020966049 7:14870127-14870149 GGCTGCAGTTAGGTTTAGAAAGG - Intronic
1028739022 7:94250860-94250882 AGATGAAGATAGATTAAGCTAGG + Intergenic
1030164181 7:106536357-106536379 GGATGCAAGAAGGTTATGATCGG + Intergenic
1030324342 7:108203982-108204004 AGATGCAGAGAGGTGAAGGTAGG - Intronic
1032020977 7:128406980-128407002 GGGTACAGATAGGTTCACATGGG + Intronic
1035227952 7:157443918-157443940 TGCTGCAGATAGTTTAAGACAGG + Intergenic
1036725183 8:11214223-11214245 GGATGAAGAAAGGTCAAGCTTGG + Intergenic
1037003858 8:13752371-13752393 ACATGCAGAAAGGTTGAGATAGG + Intergenic
1037832257 8:22196586-22196608 GGATGCAGTAAGGAGAAGATGGG - Intronic
1038123501 8:24644605-24644627 TGATGCACATAGGATGAGATAGG - Intergenic
1039085183 8:33772815-33772837 TGTTGCAGATTGGTTAAGATGGG + Intergenic
1042432072 8:68718321-68718343 GGATATATATAGGTAAAGATTGG - Intronic
1043220863 8:77661935-77661957 GGATGCTGATTGGTTGAGTTAGG - Intergenic
1044262091 8:90137293-90137315 AAATATAGATAGGTTAAGATTGG - Intergenic
1047578519 8:126185886-126185908 GGATGTAGATACATTAAGAGAGG - Intergenic
1048231184 8:132643432-132643454 GGAGGCAGGTAGGATAAGAAAGG + Intronic
1049342476 8:142120596-142120618 AGATGTAACTAGGTTAAGATGGG - Intergenic
1055067726 9:72135531-72135553 AGATGCCGTTAGGTGAAGATAGG - Intronic
1057125432 9:92612546-92612568 GGATACAAATAGATGAAGATGGG + Exonic
1059754902 9:117283554-117283576 GGGTGCAGTGAGGTTAAGAAGGG + Intronic
1186945164 X:14558054-14558076 GAATGGAAATAGGATAAGATGGG + Intronic
1188732446 X:33666985-33667007 GGATGCAGTTTCTTTAAGATTGG + Intergenic
1191963295 X:66727218-66727240 GGAAGGAGATTGGTTAATATGGG - Intergenic
1196190122 X:112785379-112785401 TGATGCTGATAGGAAAAGATAGG - Intronic
1200910593 Y:8528283-8528305 GGATGCAGTCTGGTTAGGATTGG + Intergenic