ID: 951590860

View in Genome Browser
Species Human (GRCh38)
Location 3:24262817-24262839
Sequence GACGGTAAACACCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951590854_951590860 -9 Left 951590854 3:24262803-24262825 CCTACCCCCTACTAGACGGTAAA 0: 1
1: 0
2: 1
3: 4
4: 65
Right 951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 151
951590850_951590860 1 Left 951590850 3:24262793-24262815 CCTATTTTCCCCTACCCCCTACT 0: 1
1: 0
2: 9
3: 67
4: 462
Right 951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 151
951590853_951590860 -8 Left 951590853 3:24262802-24262824 CCCTACCCCCTACTAGACGGTAA 0: 1
1: 0
2: 0
3: 9
4: 52
Right 951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 151
951590849_951590860 27 Left 951590849 3:24262767-24262789 CCTTTGAATATACTTCTAATATA 0: 1
1: 0
2: 5
3: 47
4: 437
Right 951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 151
951590852_951590860 -7 Left 951590852 3:24262801-24262823 CCCCTACCCCCTACTAGACGGTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951590860 Original CRISPR GACGGTAAACACCATGAGGA AGG Intronic
900321974 1:2089220-2089242 GATGGCAGACGCCATGAGGAAGG + Intronic
901424842 1:9175653-9175675 GACTGTAAAGACCATCAGGGTGG + Intergenic
904011857 1:27394400-27394422 GATGCCAAACACCATGAAGAAGG - Exonic
904355480 1:29936288-29936310 GACGCTAAACAACATCAGGCAGG - Intergenic
904401764 1:30261388-30261410 GATGGTAATGACTATGAGGATGG + Intergenic
905392914 1:37649735-37649757 GAAGGTAAACTCCATGAGGGCGG - Intergenic
905468900 1:38176733-38176755 GACTGTAAACACTATGTGAAGGG + Intergenic
905539583 1:38749226-38749248 GACTGTAAACCCCAAGAGGCCGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912764278 1:112395052-112395074 GACTGTAAACTGCATGAGGCAGG + Intergenic
912768562 1:112439763-112439785 TACAGGAAACACCATGAGGTTGG - Intronic
912964179 1:114222968-114222990 GAGTGTAAACTCCATGAGGCAGG + Intergenic
914345690 1:146796729-146796751 GGCTGTAAACTCCATTAGGATGG - Intergenic
917361539 1:174181717-174181739 GACTGTAACCACCATTAGTAGGG + Intronic
918077866 1:181184005-181184027 GACTGAAAGCTCCATGAGGAAGG - Intergenic
920387591 1:205579792-205579814 GACGGCAAACACCAGGGAGATGG - Exonic
920421453 1:205837122-205837144 GAATGTAAACACCATTAGAATGG + Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1072072286 10:91930423-91930445 GACCATAAACTCCATGAGAATGG - Intronic
1074512024 10:114122128-114122150 GACCATGAACTCCATGAGGATGG + Exonic
1076066371 10:127451313-127451335 GATGCTAAAAAACATGAGGATGG - Exonic
1078925323 11:15869653-15869675 GACTGTAAGCTCCATGAGGGTGG + Intergenic
1088435794 11:109811926-109811948 GTCTGTAAATACCATGAGGCTGG - Intergenic
1088451550 11:109986882-109986904 GACTATAAACTCCATGAGGCGGG - Intergenic
1089535692 11:119159723-119159745 GACGGTGTCCACCCTGAGGAAGG - Intronic
1091246211 11:134097150-134097172 GAGGGGAAACACCATGAGAGAGG + Intronic
1091967831 12:4760514-4760536 GGCTGTAGACACCAGGAGGAGGG + Intronic
1094263840 12:28531907-28531929 GATGGTAAATAGCATAAGGAAGG + Intronic
1101855410 12:108438439-108438461 GACTGTAAGCACCATGAGGTAGG + Intergenic
1102658540 12:114504433-114504455 GACAGGAAATACCAAGAGGAAGG + Intergenic
1105847698 13:24307892-24307914 GTCGGGAAACACCAGGAGGATGG + Intronic
1107377047 13:39815196-39815218 GAAGCAAAACACCATGAGGGTGG + Intergenic
1107438611 13:40404069-40404091 GAAAGTAAACACCAAGAGAAAGG + Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1107828916 13:44356979-44357001 GGCTGTAAACTCCATAAGGATGG - Intergenic
1114414249 14:22529338-22529360 GACCGTAGACACCAGGAGGACGG + Intergenic
1114513923 14:23285645-23285667 GACGATAAGCCCCATGAGGCAGG + Intronic
1114556426 14:23564978-23565000 GACAGTGAACTCCATGAAGAAGG - Intronic
1115351047 14:32396264-32396286 AAAGCTAAACACCATGAGGCTGG - Intronic
1118428039 14:65688872-65688894 GAAGGTAAACACCAGGAAGAAGG - Intronic
1118781106 14:69008397-69008419 GACCATAAACCCCATGAGGCAGG - Intergenic
1118925064 14:70184646-70184668 GAGGGTAAACCCCATGATAATGG - Intronic
1119489631 14:75019868-75019890 GACCATAAGCGCCATGAGGATGG - Intronic
1119779322 14:77267721-77267743 GATGGTGAGCACCTTGAGGAAGG - Intronic
1123676560 15:22715069-22715091 GACGATGTACTCCATGAGGAAGG - Intergenic
1124328778 15:28789329-28789351 GACGATGTACTCCATGAGGAAGG - Intergenic
1124786507 15:32686388-32686410 GACTGTGAACACCGTGAAGAAGG + Intronic
1125741310 15:41966639-41966661 GAAGGAACACAACATGAGGAGGG + Intronic
1126304954 15:47245364-47245386 GACAGTAAAGTCCATCAGGATGG - Intronic
1129913963 15:79251621-79251643 GAGGCTAAACACGGTGAGGAGGG - Intergenic
1130717063 15:86345308-86345330 GAGGTTAAACACCAGGGGGATGG - Intronic
1131385629 15:92004306-92004328 TACGGTGAAGACCATGACGATGG + Intronic
1131779237 15:95838420-95838442 GATGGTAAGCTCCTTGAGGATGG - Intergenic
1132523328 16:401527-401549 CCCCGTAAACACCATGGGGAGGG - Intronic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1134024142 16:10941853-10941875 GACGATGTACTCCATGAGGAAGG + Exonic
1137595879 16:49723347-49723369 GACGGTACAGACCTTGGGGAAGG + Intronic
1138271582 16:55699644-55699666 GACACTACACACCAGGAGGAAGG - Exonic
1138271813 16:55701148-55701170 GCAGGTAAACAAAATGAGGATGG + Intronic
1138831267 16:60377708-60377730 GGCTGGAAACATCATGAGGATGG + Intergenic
1138846682 16:60575283-60575305 GACAGTAAACACGAGGAGAAAGG - Intergenic
1139618790 16:68119778-68119800 GAATGTAAGCTCCATGAGGAGGG + Intronic
1139988296 16:70918538-70918560 GGCTGTAAACTCCATTAGGATGG + Intronic
1140309610 16:73836287-73836309 GACAGTAAGCAACTTGAGGATGG + Intergenic
1142118339 16:88372813-88372835 GATGGTAAAGATCATGATGATGG - Intergenic
1143986880 17:10922369-10922391 GACTTTAAACTGCATGAGGAGGG - Intergenic
1148128859 17:45250698-45250720 GGCTGCACACACCATGAGGAGGG - Intergenic
1148482859 17:47971337-47971359 GGCGGGAAACACGGTGAGGAGGG - Intronic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1155515078 18:26616313-26616335 AACCTTAAAAACCATGAGGAAGG - Intronic
1155667951 18:28334393-28334415 GACTGTATACACCTGGAGGAAGG - Intergenic
1156308732 18:35903929-35903951 CACTGTGAACACCATGAGGCTGG + Intergenic
1160735890 19:662364-662386 GGCTGTAAACACCTGGAGGAAGG + Intronic
1161152607 19:2717543-2717565 GACGGAGAACACCAGGATGAAGG + Exonic
1164863887 19:31587821-31587843 GAATGTAAGCTCCATGAGGATGG + Intergenic
1165439533 19:35816735-35816757 GACTGTGAACACCATGAGGTCGG + Intergenic
1166137878 19:40788153-40788175 GAATGTCAGCACCATGAGGATGG - Intronic
1166472076 19:43087141-43087163 GACAGTAAATTCCATGATGAGGG + Intronic
1166850329 19:45757025-45757047 GACTGTAAGCTCCCTGAGGATGG + Intronic
926367943 2:12150725-12150747 GACTGTAACCGCCATGAGAATGG + Intergenic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
927471021 2:23376779-23376801 GACTGTGAACACCAGGAGGTAGG - Intergenic
930403364 2:50921176-50921198 AACATTAAACACAATGAGGATGG + Intronic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
932438069 2:71714804-71714826 GAGTGTAAACCCCAGGAGGAGGG + Intergenic
932457786 2:71860600-71860622 GACTGTGAACTCCTTGAGGAAGG - Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
935649620 2:105371116-105371138 CCCAGTAAACACCATGAGAAAGG + Intronic
935848469 2:107192668-107192690 GAGGGTAACCACCAGGAGGTGGG + Intergenic
940038457 2:149333669-149333691 GACGGTAAACTTCATTAGCAAGG - Intronic
940908718 2:159191479-159191501 GGGGGTAAAGACCATGAGGCCGG + Intronic
942404066 2:175634363-175634385 GACTGTAAACCCCTTGAGGTAGG - Intergenic
942485245 2:176432397-176432419 GATGGTAAATTCCAAGAGGAAGG - Intergenic
942699845 2:178693442-178693464 GACGGGAAGAACCATGAGGAAGG - Intronic
944637405 2:201688298-201688320 GAATGTAAACTCCATGAGAATGG - Intronic
945660652 2:212681496-212681518 GAGGGTAAACATCATGAGGCAGG + Intergenic
946517095 2:220424510-220424532 AAAGGTAAACATCATGAAGACGG + Intergenic
946788094 2:223269345-223269367 GAAGGTAAACTTCTTGAGGATGG + Intergenic
947753253 2:232543593-232543615 GATGGTCACCACCAGGAGGAAGG - Exonic
948013329 2:234667898-234667920 GGTGGTAAATACCATGAGGCAGG - Intergenic
1169905755 20:10601574-10601596 GACGGCAAACACCGAAAGGATGG + Intronic
1171170953 20:23015042-23015064 GATGGGGAACACCATGAGCATGG + Intergenic
1172049859 20:32109236-32109258 GACTGTAATCCCCATGAGGGTGG - Intergenic
1172220483 20:33271173-33271195 GACTGTAAACTCCATGAGGAAGG - Intergenic
1174714203 20:52739390-52739412 GACTGTGAACTCCATGAGGATGG + Intergenic
1179304950 21:40145278-40145300 GAATGTAAGCTCCATGAGGACGG - Intronic
1182933384 22:34196068-34196090 GACTGTAGTCACCATGAGGCAGG - Intergenic
949529112 3:4936540-4936562 GATGCTGAACACCCTGAGGATGG - Intergenic
950772636 3:15324356-15324378 GACGGCAAGCTCCATGAGGCAGG + Intronic
951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG + Intronic
955487630 3:59450549-59450571 GACGGTAAACTCCATGAGGCAGG + Intergenic
955749713 3:62175649-62175671 GAATGTAAACTCCATGATGAGGG - Intronic
956647903 3:71474972-71474994 GATGGGAAACTCCATGAGGAAGG - Intronic
959432266 3:106269874-106269896 GAATGTAAGCTCCATGAGGACGG + Intergenic
960604200 3:119488258-119488280 GATGGTAAACTCCTTGATGAGGG - Intronic
963951368 3:151205896-151205918 GGCTGAAAACTCCATGAGGAAGG - Intronic
966657718 3:182378400-182378422 GAATGTAAATACCTTGAGGATGG - Intergenic
967803731 3:193693809-193693831 CACGGTAACCACCATGATTAGGG - Intronic
968470570 4:780512-780534 GAAGGTATACACCATGAGCCTGG - Intergenic
968471871 4:786237-786259 GGCGGTAAACAGCAAGAGAAAGG + Exonic
968714739 4:2148036-2148058 GACTGTAAATTCCATGAGAATGG - Intronic
971261569 4:25062029-25062051 AAGTGTAAACTCCATGAGGACGG - Intergenic
973603451 4:52563805-52563827 GACTGGGAACACCTTGAGGAGGG + Intergenic
973639300 4:52887210-52887232 TACTGTAAGCACCTTGAGGATGG - Intronic
974943712 4:68500747-68500769 GACTGTAAACTCCATGAGGGTGG + Intergenic
975248960 4:72154712-72154734 GAGGGCAAAAACCATGAAGAGGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
982445866 4:155490147-155490169 GACAGTAATCACCATAAAGATGG + Intergenic
983339163 4:166435648-166435670 GACAGTAAATTCCATGAGCATGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986649301 5:9947943-9947965 GACTGTAACAGCCATGAGGATGG - Intergenic
991934060 5:71784377-71784399 GAATGTAAACTCCATGAGGAGGG + Intergenic
995903207 5:117093782-117093804 GGCGGTAAACACCTAGATGAGGG + Intergenic
996653606 5:125913331-125913353 GACAGTAGTCACCATGGGGATGG - Intergenic
998478362 5:142440565-142440587 GAATGTAAACTCCAGGAGGATGG + Intergenic
998676944 5:144420110-144420132 AAATATAAACACCATGAGGAAGG - Intronic
999164122 5:149533286-149533308 GGTGATAAACACCATGATGAAGG + Intronic
1001859817 5:175044188-175044210 GACAGGAAACACCCTGAAGATGG - Intergenic
1003963944 6:11235469-11235491 GACTGTAAGCTCCATGAAGATGG - Intronic
1005397562 6:25398975-25398997 CACGTTTAACTCCATGAGGAAGG - Intronic
1005691496 6:28311304-28311326 GTGGGTAAAGACCATCAGGATGG + Intergenic
1008256034 6:49301168-49301190 AAAGATAAACAACATGAGGAAGG - Intergenic
1008906218 6:56680462-56680484 GACTGTAAGCTCCATGAGGATGG - Intronic
1017964693 6:159253979-159254001 GACGGGAAATGCCGTGAGGAGGG + Intronic
1020407143 7:7849655-7849677 AATGGTAAACTCCATGAGGCAGG - Intronic
1024584465 7:50829627-50829649 GACAGTGATCACCATGAGGCAGG - Intergenic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1025016444 7:55442737-55442759 GCTGGAAAATACCATGAGGATGG + Intronic
1027815124 7:82958952-82958974 TACAGTAAACACCATCATGATGG + Intronic
1028086004 7:86638679-86638701 GACTGTAAACTTCAGGAGGAGGG - Intergenic
1031398526 7:121302935-121302957 GAATGTAAACTCCATGCGGAAGG + Intergenic
1034102757 7:148465085-148465107 GACAGACAACACCATGGGGAAGG - Intergenic
1037385489 8:18335775-18335797 GAAGTTAAACACAATGAAGATGG + Intergenic
1038237724 8:25777013-25777035 GACTGTAAACACTTTAAGGATGG + Intergenic
1038271678 8:26080847-26080869 GATGGTAAATGCCAAGAGGATGG - Intergenic
1041448921 8:57986413-57986435 GACTGTCAACTACATGAGGATGG - Intergenic
1041717147 8:60942756-60942778 GGGGGTGAACACCAGGAGGATGG + Intergenic
1045460796 8:102424059-102424081 GACTGTAAGCCCCATGAGGCTGG - Intergenic
1046517112 8:115276857-115276879 GTCTGTAAAAACCAAGAGGAAGG + Intergenic
1047979418 8:130164993-130165015 GATGATAAACAGCATGAGAAAGG + Intronic
1047994829 8:130324298-130324320 GAAGGTAAACATCATGGGTAAGG + Intronic
1049127695 8:140807008-140807030 GAAGGAAAGCCCCATGAGGATGG + Intronic
1050694477 9:8263287-8263309 GGCAGTAAACACCCTGGGGAGGG - Intergenic
1059731166 9:117058729-117058751 GACTGGAAACTTCATGAGGATGG - Intronic
1186582598 X:10836758-10836780 GACTGTAAGCTCCATGAGGGTGG - Intergenic
1189994085 X:46622512-46622534 AACGATAAACATCATCAGGAAGG + Intronic
1190795534 X:53737727-53737749 AACTGAAATCACCATGAGGAGGG + Intergenic
1196017776 X:110957705-110957727 GTAGGAAAACACCATGAGCAAGG - Intronic