ID: 951591925

View in Genome Browser
Species Human (GRCh38)
Location 3:24275670-24275692
Sequence CGGCAAAAACCAGAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951591925_951591929 2 Left 951591925 3:24275670-24275692 CCATCCAACTCTGGTTTTTGCCG 0: 1
1: 0
2: 1
3: 13
4: 185
Right 951591929 3:24275695-24275717 TTCTTTTCTGTCCCCTTCTTTGG 0: 1
1: 0
2: 8
3: 51
4: 705
951591925_951591933 24 Left 951591925 3:24275670-24275692 CCATCCAACTCTGGTTTTTGCCG 0: 1
1: 0
2: 1
3: 13
4: 185
Right 951591933 3:24275717-24275739 GACTTTATGAACTGACTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951591925 Original CRISPR CGGCAAAAACCAGAGTTGGA TGG (reversed) Intronic
902955309 1:19921237-19921259 CAGCAACACCCAGGGTTGGAAGG + Intronic
903324311 1:22561096-22561118 GGGCAAAACCCAGATTTGGTTGG + Intergenic
903955254 1:27021161-27021183 GGACAAAAACCAGAGAAGGAGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908962163 1:69711057-69711079 CTGTAAGAATCAGAGTTGGAGGG - Intronic
909525301 1:76615380-76615402 CTCCAAAAACAAGAGTTGGCAGG + Intronic
909812807 1:79952809-79952831 TGGCACAAAATAGAGTTGGATGG - Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
914419611 1:147517381-147517403 CGGGAAAAAAAAGACTTGGAAGG - Intergenic
916509706 1:165461216-165461238 CTGGAAAAACCAGGTTTGGAGGG - Intergenic
920251804 1:204627035-204627057 TGGCAACAACTAGAGTTGAAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922987731 1:229879072-229879094 CTGCAAAAAGGAGAATTGGATGG + Intergenic
923955436 1:239013173-239013195 CGGAAGAAACCAGAGTTAAAAGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066361956 10:34739932-34739954 AGGGCAGAACCAGAGTTGGAAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070023955 10:72613821-72613843 CAACAAAAACTAGAGTTGTAAGG - Intronic
1070790817 10:79188337-79188359 GGGCAAAGGCCAGAGTAGGAAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072220421 10:93323174-93323196 CTGCAAGAAGCACAGTTGGAAGG + Intronic
1074119055 10:110479759-110479781 AGGCAAAAACCAGGGGTGGCTGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076507804 10:130989463-130989485 AGGCAAAAACCAGGCTCGGATGG - Intergenic
1079304100 11:19307439-19307461 CGGGAAAAATAAGAGTTGGAAGG + Intergenic
1081808363 11:45902003-45902025 GGGCAAAAAGCACAGTTGGCAGG + Exonic
1083090713 11:60197296-60197318 AGACAAAAACCAGAATTTGAGGG + Intergenic
1083101663 11:60313457-60313479 AGACAAAAACCAGAATTTGAGGG - Intergenic
1083434128 11:62631050-62631072 CGGAAAACATCAGAGATGGAGGG + Exonic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1088105778 11:106204994-106205016 CTGAAAGAACCAGACTTGGAAGG - Intergenic
1093490208 12:19696960-19696982 CTACAGAAACCAGAGTTGCAAGG + Intronic
1094049466 12:26203322-26203344 CATCAAAATCCAGAGCTGGATGG + Intronic
1095909536 12:47412044-47412066 AGGCAAAAACCAGAATTTGTAGG + Intergenic
1095944166 12:47744711-47744733 CGGAAAAAAGCAGGGTGGGAAGG - Intronic
1096153440 12:49329043-49329065 TGACACAAACCAGAGTTGGAGGG - Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1100147081 12:91691149-91691171 CCGCAAAAACCAGATCTGCAAGG - Intergenic
1104663229 12:130627513-130627535 CGGGAAAATCCACAGTTCGATGG - Intronic
1104713713 12:131003424-131003446 TGGCACAAACCACATTTGGAAGG + Intronic
1106096580 13:26650428-26650450 AGGCAAAAAACACAGTTTGAAGG + Intronic
1106961912 13:35008924-35008946 CTGTAAAAACAACAGTTGGAGGG - Intronic
1107703880 13:43079450-43079472 CAGAAAAAACAAGAGTTGGGAGG + Intronic
1108364212 13:49693721-49693743 AGGCAGAAACCAGAGTAGAAAGG - Intergenic
1108547256 13:51508304-51508326 TGGCAAAAGGTAGAGTTGGAGGG - Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1109671135 13:65609775-65609797 CGGCCAAAATCTGAGTTGAATGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113920684 13:113907380-113907402 AGGCAGAAACCAGAGATGGGAGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114675635 14:24438485-24438507 ATGAAAGAACCAGAGTTGGAAGG + Exonic
1118567157 14:67154085-67154107 AGGCAGAAGCCAGAGTTGCAGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120074854 14:80144383-80144405 CTTCAAAAACCAGACTTGGAGGG + Intergenic
1120909843 14:89656333-89656355 AGGCCAAAGCCAGAGTTAGAAGG - Intergenic
1202940031 14_KI270725v1_random:137269-137291 CGGCAAAAACCCGCGGTGGCGGG + Intergenic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127924585 15:63526810-63526832 AGGCAGAAAGTAGAGTTGGAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133442295 16:5830970-5830992 ACGCAAAAAACAGAGTTGGGGGG - Intergenic
1137348698 16:47690711-47690733 CGGCAAAAACCATCATTGCATGG + Intronic
1140356415 16:74310714-74310736 AGCCAACAACCTGAGTTGGAAGG + Intergenic
1144218448 17:13078641-13078663 CGTAAAATATCAGAGTTGGAAGG + Intergenic
1145694017 17:26773746-26773768 CGGCAAAAACCCGCGGTGGCGGG - Intergenic
1149098326 17:52871811-52871833 TGGCAAAGACCAAAGTTGCAAGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149333955 17:55615730-55615752 AAGGAAAAAACAGAGTTGGAAGG - Intergenic
1149964069 17:61144112-61144134 CGGCAAAAAAAAGAGTAGAAAGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154979412 18:21490162-21490184 AGGCAAAAACAAAAGTGGGAGGG + Exonic
1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
928430822 2:31217143-31217165 CGAGAGAAACCAGAGCTGGAGGG + Intronic
929422122 2:41802940-41802962 AGGCAAAAATCAGAGTTTGAAGG - Intergenic
929431763 2:41893308-41893330 GAACAAAAAACAGAGTTGGAGGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934724468 2:96606536-96606558 TGGCTAAAATCAGAGTAGGAAGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
938210800 2:129464568-129464590 TGGCAAAACCCACAGTGGGAGGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940894143 2:159064246-159064268 GGGCAAACACTAAAGTTGGAAGG - Intronic
942135291 2:172919329-172919351 GGGCAAAATCCAGACTTTGAGGG - Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942819028 2:180089296-180089318 CTGGAAAAATCTGAGTTGGATGG - Intergenic
943355951 2:186856168-186856190 GGGCAAATACCAAACTTGGAAGG - Intergenic
944206581 2:197164135-197164157 GGGCTAGAACCAGAGTTGGTGGG + Intronic
948590776 2:239048152-239048174 GGGCAGAAACCAGAGCTGGGAGG + Exonic
1171239031 20:23550490-23550512 CGGCAAACTCCAGGGTGGGAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172899243 20:38321801-38321823 CTGCAAAGACAAGGGTTGGAGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173899969 20:46580580-46580602 CAGTAAAAGCCAGAGGTGGAAGG + Intronic
1176583144 21:8549765-8549787 CGGCAAAAACCCGCGGTGGCGGG - Intergenic
1176689954 21:9894062-9894084 AGGCAAAAACCAAAGATTGAAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1180122028 21:45759543-45759565 CAGTAAAAACCAGAGAAGGAAGG - Intronic
1180265941 22:10526657-10526679 CGGCAAAAACCCGCGGTGGCGGG - Intergenic
1180885361 22:19239707-19239729 AGGCAGAGAGCAGAGTTGGAAGG - Intronic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
954918297 3:54167345-54167367 AGGCATTAATCAGAGTTGGAGGG - Intronic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965074552 3:163959808-163959830 AGGCAACAACCATAGTAGGAGGG - Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966549432 3:181187804-181187826 CAGTGAAAACCAGACTTGGAAGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
971683445 4:29732491-29732513 TGGCAAACACCTGAATTGGAGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973317871 4:48780217-48780239 CGGTTAAAATCAGAGTCGGAGGG - Exonic
973353235 4:49115896-49115918 TGGAAAAAACCCGAGTGGGAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978843894 4:113248946-113248968 GGGCAAAAAGCAGAGTGGGTGGG - Intronic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983177754 4:164611363-164611385 GGGTAAAAACTAGAGTGGGAAGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984185313 4:176536469-176536491 CTGCAGAACCCAGAGTTGCAGGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
988008771 5:25455113-25455135 TGGAAAAAACCAGAGTAGGCAGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
991250387 5:64554055-64554077 GGGCAAAGAGCAGATTTGGAGGG - Intronic
991948333 5:71923351-71923373 CTGCCAAAACAAGTGTTGGAAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
998482313 5:142473157-142473179 AGGCACACACCAGAGTTGGAAGG - Intergenic
1000029685 5:157390968-157390990 CACCAAATACCAGAGTTGTACGG + Intronic
1000659258 5:163918332-163918354 TGTCAAAAACCAGAGTTGGAAGG - Intergenic
1002314275 5:178333310-178333332 AGGCCAAACCCAGACTTGGAAGG - Intronic
1003365254 6:5468032-5468054 CACCAAATATCAGAGTTGGAAGG + Intronic
1004354636 6:14920427-14920449 CAGCAGACACCAGAGCTGGAAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1007478683 6:42135974-42135996 CAGGAAAAACAAGAGATGGAGGG - Intronic
1008050508 6:46895886-46895908 AGGTAGAGACCAGAGTTGGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013174030 6:107662289-107662311 CAGCAAAAGCCAGAGTTGGGAGG - Intergenic
1013614190 6:111826298-111826320 CAGTAAAAGCCAGAGTTGGGAGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014583168 6:123162703-123162725 CTGCAAGAACCAGAGTTACAGGG + Intergenic
1015980174 6:138830547-138830569 GGGCAAAAACCAGTTTAGGATGG - Intronic
1016551503 6:145285265-145285287 CAGCAAAAAGCTGACTTGGAAGG + Intergenic
1018611883 6:165654878-165654900 CGGCAAGATCCTGAGATGGAAGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1025553718 7:62277053-62277075 CGGCAAAAAGCCGCGTTGGCGGG + Intergenic
1026139146 7:67690164-67690186 AGGCAAAAACAAGAAGTGGAAGG - Intergenic
1027462730 7:78475686-78475708 CGGAATAAATCAGAGTTGGAAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031786290 7:126037960-126037982 TGGCAAAAACCTCAGATGGAGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034624853 7:152484782-152484804 CTGCAAAAAGCAGAGTAGGCCGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041022124 8:53648556-53648578 AAGCAAAAACCAGGGTTGGTGGG + Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046032314 8:108797825-108797847 AGGCAAATCCCAGAGTGGGAAGG + Intergenic
1048049561 8:130804619-130804641 GGGCATAAACCAAAGTGGGAAGG - Intronic
1052879884 9:33595070-33595092 CAGTGAAAACCAGACTTGGAAGG + Intergenic
1053496095 9:38549150-38549172 CAGTGAAAACCAGACTTGGAAGG - Intronic
1055311502 9:74986701-74986723 CGGCTAAAGCTTGAGTTGGAGGG - Intronic
1056378308 9:86035433-86035455 CAGGAAAATCCAGAGATGGAGGG - Exonic
1056751620 9:89355861-89355883 CAGAAAAAACCGGAGTTTGATGG - Intronic
1060815099 9:126631028-126631050 CGACTAGAACCAGAGCTGGAGGG - Intronic
1203613119 Un_KI270749v1:27592-27614 CGGCAAAAACCCGCGGTGGCGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196510159 X:116499782-116499804 GGGCACAAAACAGAGTTGCAAGG - Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199293688 X:146133787-146133809 CTGCAAAGAACAAAGTTGGATGG - Intergenic
1199453409 X:147998848-147998870 CGGAAGAAACCAAAGGTGGAGGG + Intronic
1200043379 X:153386649-153386671 CGGCAAAAACAATAGGTGGAAGG - Intergenic