ID: 951594598

View in Genome Browser
Species Human (GRCh38)
Location 3:24303629-24303651
Sequence TGATAGTTATGCAACATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951594594_951594598 30 Left 951594594 3:24303576-24303598 CCCTGATTCCCACTGTGAGCTAC 0: 1
1: 0
2: 0
3: 10
4: 173
Right 951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG 0: 1
1: 0
2: 0
3: 9
4: 104
951594595_951594598 29 Left 951594595 3:24303577-24303599 CCTGATTCCCACTGTGAGCTACA 0: 1
1: 1
2: 1
3: 13
4: 136
Right 951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG 0: 1
1: 0
2: 0
3: 9
4: 104
951594597_951594598 21 Left 951594597 3:24303585-24303607 CCACTGTGAGCTACACATGTTAA 0: 1
1: 0
2: 4
3: 10
4: 133
Right 951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG 0: 1
1: 0
2: 0
3: 9
4: 104
951594596_951594598 22 Left 951594596 3:24303584-24303606 CCCACTGTGAGCTACACATGTTA 0: 1
1: 0
2: 3
3: 80
4: 530
Right 951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951594598 Original CRISPR TGATAGTTATGCAACATTAC TGG Intronic
902306800 1:15547021-15547043 TGATGGTTATGTAAAATTTCTGG - Intronic
902353303 1:15875631-15875653 GGATAGTTATAAAAAATTACTGG - Intronic
909377663 1:74958559-74958581 TGATAGTGATGTAACGTTATAGG + Intergenic
913192213 1:116422513-116422535 TGAGATTTATGCAGCATCACGGG + Intergenic
913376673 1:118160244-118160266 AGATAGTGATGCAACATTGAAGG - Intronic
917781842 1:178405533-178405555 TCATAGAGATGCAACATTGCTGG + Intronic
919558353 1:199089877-199089899 TGAGAGATATGCAACATCTCTGG + Intergenic
921920927 1:220668250-220668272 TGATATTTATGAAACATTTTAGG - Intergenic
1065592151 10:27274753-27274775 TGATAGTTATGGCACTATACAGG + Intergenic
1066748091 10:38622723-38622745 GGATAGTGATGGAAAATTACAGG - Intergenic
1068534097 10:58221249-58221271 TGATAGTTGAGCAACTTTAAGGG - Intronic
1072701830 10:97647766-97647788 TTATGGTTATGCAATAGTACAGG - Intronic
1079840383 11:25390435-25390457 TGATAGTTCTTAAACATAACAGG + Intergenic
1087352973 11:97056786-97056808 TGAGTGTTCTTCAACATTACGGG - Intergenic
1087785998 11:102354770-102354792 TGATAATAAGGCATCATTACAGG + Intronic
1087788143 11:102378441-102378463 TGCTTGTTATGCATCATTTCAGG + Exonic
1088171494 11:107002796-107002818 TGCTAGATATACAAAATTACTGG + Intronic
1088502582 11:110497431-110497453 TTATTATTATGCAACATTGCTGG + Intergenic
1089862565 11:121602983-121603005 TGAGAGACATGCAACATCACTGG - Intronic
1092460438 12:8681461-8681483 TGATGGTTACGCAACATCAGGGG - Intergenic
1092580923 12:9840266-9840288 TGATAGTTGTACAACATTGTGGG + Intronic
1093115726 12:15208344-15208366 TGACAGGAATGCAACATGACCGG - Intronic
1093340680 12:17969207-17969229 TTATATTTATGTAACATTATGGG - Intergenic
1094724104 12:33094910-33094932 AGATAGCTATGCATCATTAAAGG + Intergenic
1097314954 12:58161991-58162013 TGATTGTCATCCAACATTCCTGG + Intergenic
1097652060 12:62311256-62311278 TGAAAATTGTGAAACATTACTGG + Intronic
1100075425 12:90775332-90775354 TGTTAGTGATGCAACATCTCAGG + Intergenic
1100714873 12:97295115-97295137 TCATAGTTATGGTTCATTACAGG + Intergenic
1104623619 12:130336749-130336771 TTATAGTTATGGAACATAACAGG + Intergenic
1105878463 13:24581767-24581789 TGCTAGTTCTGAAACATCACTGG + Intergenic
1108120230 13:47177840-47177862 TAATAGTTATGCATATTTACAGG + Intergenic
1108626621 13:52235152-52235174 TGCTAGTTCTGAAACATCACTGG - Intergenic
1108659449 13:52571339-52571361 TGCTAGTTCTGAAACATCACTGG + Intergenic
1109444053 13:62409804-62409826 TGATAGTTATGCGACAAAAAGGG + Intergenic
1109935328 13:69275936-69275958 TGATAGCAATACAACATTTCTGG - Intergenic
1110429450 13:75406985-75407007 TGATAGTTATGTATCATTTCAGG + Intronic
1115185378 14:30682665-30682687 TGATTATAATGCAGCATTACTGG + Intronic
1117696973 14:58375482-58375504 TGATAGCTATGTTAAATTACAGG - Intergenic
1123876053 15:24625131-24625153 TTATAGTTATGCAACTTTTCTGG + Intergenic
1126653043 15:50945481-50945503 TGATCCATATGGAACATTACAGG - Intronic
1126664656 15:51065572-51065594 TGATGGTTATAAAACATGACAGG + Intronic
1130201075 15:81827404-81827426 TCACAGTGATGCAACAATACGGG + Intergenic
1131633423 15:94204139-94204161 TGATAGTGATGCAACAATGTAGG + Intergenic
1136734671 16:32454578-32454600 AGATAGTGATGGAAAATTACAGG + Intergenic
1203018410 16_KI270728v1_random:375018-375040 AGATAGTGATGGAAAATTACAGG - Intergenic
1203036745 16_KI270728v1_random:648176-648198 AGATAGTGATGGAAAATTACAGG - Intergenic
1158255411 18:55542062-55542084 TTATAGATATGCACAATTACTGG - Intronic
1164083972 19:21885009-21885031 TAATCTTTTTGCAACATTACGGG - Intergenic
1164578571 19:29420102-29420124 TGATGCTTATGCGTCATTACTGG - Intergenic
928799791 2:35073829-35073851 TGAAATTCATGCAACATTAGTGG - Intergenic
928799862 2:35074939-35074961 TGAAATTCATGCAACATTAGTGG + Intergenic
933616190 2:84484599-84484621 TCAGAGTGATGCAGCATTACTGG - Intergenic
934311058 2:91864869-91864891 GGATAGTGATGGAAAATTACAGG - Intergenic
940670205 2:156658332-156658354 TCAAAGATATGCAAGATTACAGG - Intergenic
941254936 2:163217254-163217276 TCATAGTTATGGTACATTACAGG + Intergenic
942861692 2:180621409-180621431 TTAAAGTTATGCAAGATGACTGG + Intergenic
944311192 2:198235616-198235638 TGATAGTTAAGCAAAATGTCTGG + Intronic
1170849212 20:19988799-19988821 TGATATTTTTGCAACTTTCCTGG - Intronic
1176739790 21:10590568-10590590 TGCTAGTTCTGAAACATCACTGG + Intronic
1177885335 21:26739893-26739915 TGATATTGATTCAACATTAGTGG + Intergenic
1180537816 22:16410790-16410812 GGATAGTGATGGAAAATTACAGG - Intergenic
951594598 3:24303629-24303651 TGATAGTTATGCAACATTACTGG + Intronic
953445197 3:42957717-42957739 TGAAAGTGATGCAATGTTACTGG + Intronic
955495101 3:59522803-59522825 TGAGTGTTAAGTAACATTACTGG + Intergenic
955708341 3:61752409-61752431 TACTAGATATTCAACATTACTGG - Intronic
956999412 3:74867859-74867881 TCATAGTTATGTACCATTATTGG + Intergenic
957799493 3:85057330-85057352 TGAAAGTTCTGTAACACTACAGG - Intronic
958812461 3:98877511-98877533 TAATACTAATGCAACATTATAGG - Intronic
960976109 3:123176111-123176133 TGATAGTTATGAAAAACTAGGGG + Intronic
962342656 3:134598223-134598245 TAATAGTTATGCACCACCACAGG - Intronic
964836813 3:160948358-160948380 GCATAGTTATGCAACACTGCCGG + Intronic
965163091 3:165160345-165160367 TGATCATTATGCTACATTGCAGG - Intergenic
970573032 4:17401260-17401282 TGAGAGAGATGCAACATTGCTGG - Intergenic
971139510 4:23908923-23908945 TGATAGTTCCGCAACATCCCAGG + Intergenic
971999853 4:34017517-34017539 TGCTAGGTATGCTACAGTACAGG + Intergenic
972836265 4:42873785-42873807 TGATAATTATGCTGCTTTACTGG - Intergenic
974880821 4:67755265-67755287 GGATAGTTATTCATCAATACTGG + Intergenic
975048715 4:69832368-69832390 TGATTTTTCTGCAACATTTCTGG - Intronic
979350058 4:119633027-119633049 TAAAAGTTATAAAACATTACTGG + Intergenic
980773199 4:137405250-137405272 TGATATGTATGTAACATAACAGG + Intergenic
982937325 4:161498284-161498306 TGACAGTTTTGCAACATGTCAGG - Intronic
986904638 5:12480578-12480600 TGATACTTATAAAACATAACAGG + Intergenic
987463561 5:18245229-18245251 TGACAGTTTTGCAACATAAAGGG + Intergenic
989761614 5:45022934-45022956 TGGTGGTTGTACAACATTACTGG + Intergenic
990662249 5:58029177-58029199 TGAAAGTTATTTAATATTACAGG - Intergenic
991681551 5:69144952-69144974 TGAAAGTTAAGCAATATTGCCGG - Intergenic
994846012 5:104989345-104989367 TGAGATTTATGTAAAATTACTGG - Intergenic
995134131 5:108661950-108661972 TGATAGTCATCTAACACTACAGG + Intergenic
996174325 5:120336083-120336105 TGATTGGTAAGCATCATTACAGG - Intergenic
998651085 5:144122548-144122570 AGAAAGTTCTGCAACATTAGAGG - Intergenic
1000303644 5:159976741-159976763 TAAAAGTTATGGAACATTCCAGG + Intergenic
1000435211 5:161199675-161199697 TGATAGTCATGTAACACTCCTGG + Intergenic
1004576578 6:16901531-16901553 TGCTAGTTATGCATCATTTGAGG - Intergenic
1005223166 6:23611599-23611621 TTACAGTTGTGCAACATTTCAGG - Intergenic
1012152018 6:95765868-95765890 TCAAAGTTATGCAACTTGACAGG - Intergenic
1013731724 6:113176121-113176143 TGTTTGTTATGTAACATTACTGG - Intergenic
1014135168 6:117880579-117880601 TGATGGTTATATAGCATTACAGG + Intergenic
1019039893 6:169095055-169095077 TGATGGTTAAGAAAGATTACAGG - Intergenic
1022264580 7:28741627-28741649 TGACTGTTCTGCACCATTACTGG + Intronic
1031398345 7:121301188-121301210 TATTAGTTATGCAAAATCACTGG + Intergenic
1033262710 7:139857500-139857522 TGATATTTATGAAACACTTCAGG - Intronic
1035148025 7:156840277-156840299 TGATAATTATGCAACGTTAGAGG + Intronic
1040889293 8:52299353-52299375 TGAAAGTTTTTCAAGATTACAGG - Intronic
1050441302 9:5666920-5666942 TGTTATTTATGCAAAATTACTGG + Intronic
1050657258 9:7842493-7842515 GGAGAGTAATGCAACATTACTGG + Intronic
1056478931 9:86981315-86981337 TGAAAGTAATGCAACATGGCAGG - Intergenic
1059859269 9:118439858-118439880 TAATATTTATGCAATATTAGGGG - Intergenic
1186688793 X:11952862-11952884 TGTTAGAAATGCAACATTTCAGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188941849 X:36247730-36247752 TGACAGTAATGGAAGATTACAGG + Intronic
1189163634 X:38837148-38837170 CCATGCTTATGCAACATTACTGG - Intergenic
1190130196 X:47740932-47740954 GGATAGTAATGGAAAATTACAGG + Intergenic
1197220333 X:123906090-123906112 TACTATTTATGCAATATTACTGG + Intronic
1197555841 X:127952032-127952054 TGATGGTTATACAACATTATGGG - Intergenic