ID: 951599359

View in Genome Browser
Species Human (GRCh38)
Location 3:24356262-24356284
Sequence CAGGACCACCTGGAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 11, 3: 23, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951599359_951599365 0 Left 951599359 3:24356262-24356284 CCCCAAAACTCCAGGTGGTCCTG 0: 1
1: 0
2: 11
3: 23
4: 202
Right 951599365 3:24356285-24356307 AACCGCCTCAAAGGTTCCACCGG 0: 1
1: 0
2: 0
3: 3
4: 41
951599359_951599370 27 Left 951599359 3:24356262-24356284 CCCCAAAACTCCAGGTGGTCCTG 0: 1
1: 0
2: 11
3: 23
4: 202
Right 951599370 3:24356312-24356334 TCCTAGACCCAAGACTTTAGTGG 0: 1
1: 0
2: 0
3: 10
4: 76
951599359_951599363 -9 Left 951599359 3:24356262-24356284 CCCCAAAACTCCAGGTGGTCCTG 0: 1
1: 0
2: 11
3: 23
4: 202
Right 951599363 3:24356276-24356298 GTGGTCCTGAACCGCCTCAAAGG 0: 1
1: 0
2: 1
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951599359 Original CRISPR CAGGACCACCTGGAGTTTTG GGG (reversed) Intronic
900317648 1:2067451-2067473 CAGGAGCGCCTGGTTTTTTGGGG + Intronic
900458838 1:2790475-2790497 CAGGGCCACCTGGAGACTGGAGG - Intronic
900657903 1:3769099-3769121 CAGGAACCCCTTGAGTTATGCGG - Intronic
902968429 1:20029243-20029265 CAGAACTACATGGAGTTTGGTGG - Intronic
903818579 1:26083347-26083369 CAGGTTCACCTGGGGTTTGGAGG - Intergenic
906754738 1:48299971-48299993 AAGGATCAACTGTAGTTTTGAGG + Intronic
907872294 1:58454320-58454342 CAGGAGCAACTGCAGTTTGGGGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909239253 1:73191495-73191517 CAGGGACACCTGGAGCCTTGTGG + Intergenic
909731144 1:78891631-78891653 CGGCACCACCTGGATCTTTGGGG - Exonic
909818360 1:80026312-80026334 CAGGACCACCCTCATTTTTGTGG + Intergenic
910181087 1:84484112-84484134 CAGGACTACCTGGAGTAGAGAGG + Intronic
910497869 1:87853110-87853132 CAGAACCACCTGGTGGTTGGTGG + Intergenic
911198599 1:95020765-95020787 TAGAACCACTTAGAGTTTTGTGG - Intronic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
913478715 1:119263946-119263968 CTGAACCACCTGGTGTTTTCAGG - Intergenic
913478781 1:119264550-119264572 CTGAACCACCTGGTGTTTTCAGG + Intergenic
916725489 1:167518659-167518681 CAGGAAGCCCTGGAGGTTTGAGG + Intergenic
916732054 1:167575153-167575175 CATGACCACTTGGAGTTTAATGG - Intergenic
916792102 1:168134448-168134470 CAGTGCTACCTGGAGTTTGGAGG - Intronic
917485422 1:175450787-175450809 CAGGACCCCCTAGATTTTTATGG - Intronic
917961793 1:180151469-180151491 CTGGAAGACCTAGAGTTTTGAGG + Intergenic
924181793 1:241446250-241446272 TAGGATCCCCTGGAGTCTTGGGG + Intergenic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1065961907 10:30740456-30740478 CAGGAGCAAGTGCAGTTTTGTGG + Intergenic
1069629654 10:69889869-69889891 CAGGAACCCCTGGAGTCCTGGGG - Intronic
1070111766 10:73494115-73494137 CAAGAAATCCTGGAGTTTTGTGG - Intronic
1070532735 10:77351308-77351330 CAAGACCACCAGGATATTTGGGG + Intronic
1070537178 10:77388321-77388343 CAGCCCCACCAGGAGCTTTGTGG - Intronic
1070832938 10:79431371-79431393 CAGGACCCACTGGAGATGTGGGG + Intronic
1071436315 10:85651073-85651095 CAGAATCACCTGGAGGGTTGTGG - Intronic
1072830961 10:98657903-98657925 CAGGACTACCTGGTATTTTTAGG + Intronic
1073095750 10:100978723-100978745 CAGGCTCACCTGGGGATTTGGGG - Intronic
1073226079 10:101920369-101920391 CCAGACCACCTGGAGTTCTCTGG - Intronic
1075265977 10:120999807-120999829 CAGGACGTCCGGGAGTTGTGAGG + Intergenic
1076001065 10:126913418-126913440 CAGTGCCCCCTGGAGTTGTGTGG - Intronic
1077066497 11:643346-643368 CAGGACCACCTGGTTTATTCCGG - Intergenic
1077400175 11:2351741-2351763 CAGGACCACCTGGAGACTTGGGG - Intergenic
1079005285 11:16787300-16787322 CAGGACCATTTGGGGCTTTGAGG - Intronic
1083304599 11:61755872-61755894 AAAGACCACTTGGAGTTTAGTGG + Intronic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1083719472 11:64597325-64597347 CAGGACCAAGTGGAGATTTGGGG - Intronic
1084649278 11:70479202-70479224 CAGGACCACTAGGTGGTTTGAGG - Intronic
1085129502 11:74026029-74026051 CAGGAAGATCTGCAGTTTTGTGG - Intronic
1085408224 11:76276779-76276801 CAGGACCAACTGGGGGGTTGGGG - Intergenic
1085913250 11:80853500-80853522 CAGGACAACAGGGAATTTTGGGG + Intergenic
1087772609 11:102227050-102227072 CACCACCACCTGGAGAATTGAGG + Intronic
1088359335 11:108974634-108974656 CAGGACCACCTGGTATTTACTGG - Intergenic
1088385335 11:109248035-109248057 CAGTATTACCTGCAGTTTTGGGG + Intergenic
1091675488 12:2486098-2486120 CAGGACCACCTGGAGACCTGCGG - Exonic
1093108003 12:15112423-15112445 CAGTACCAGCTGGAGGTTGGTGG + Intronic
1093381603 12:18500424-18500446 CAGGAGCACATGGAGGCTTGGGG - Intronic
1097185039 12:57192238-57192260 CAGGAGCACTGGGGGTTTTGCGG - Intronic
1097844456 12:64352269-64352291 CATGACCATTTGGAGTTTGGTGG - Intronic
1099066078 12:77981246-77981268 AAGGACCACATATAGTTTTGAGG + Intronic
1100006144 12:89897862-89897884 CAGAATCACCTGGAGTGTTCTGG - Intergenic
1100328831 12:93567095-93567117 CAGGATCACAGGGAGTCTTGAGG + Intergenic
1100638120 12:96455551-96455573 AATGACCACCTTGAATTTTGAGG - Intergenic
1102346789 12:112166006-112166028 CAGAACCACATGGTGTTGTGGGG - Intronic
1104841720 12:131828908-131828930 CAGGAGCCCGTGGAGTTGTGAGG + Intronic
1109107773 13:58277055-58277077 CAGGACAACTTGGAAATTTGAGG - Intergenic
1113124518 13:106961883-106961905 CACAACCATCTGGAGTTGTGGGG + Intergenic
1115146278 14:30229600-30229622 AAGGACCACCTGTATTTTAGGGG - Intergenic
1116137070 14:40939706-40939728 CTGGACAACCTGGAGTTCTGAGG - Intergenic
1120641533 14:87019352-87019374 AAAGACCATTTGGAGTTTTGGGG - Intergenic
1121881355 14:97503171-97503193 CAGGACCACCAGGAGTGTTGGGG + Intergenic
1123137071 14:106037957-106037979 AAGGACCACCTGGTTTTTGGAGG + Intergenic
1123138577 14:106053674-106053696 AAGGACAACCTGGAGGTTTGAGG - Intergenic
1123163324 14:106301450-106301472 AAGGACCACCTGGCTTTTGGAGG + Intergenic
1123207014 14:106723629-106723651 AAGGACCACCTGGTTTTTGGAGG + Intergenic
1123212033 14:106770632-106770654 AAGGACCACCTGGTTTTTGGAGG + Intergenic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1124509417 15:30310354-30310376 TAGGCCCACCTGGATTTTGGTGG - Intergenic
1124734142 15:32228308-32228330 TAGGCCCACCTGGATTTTGGTGG + Intergenic
1125442156 15:39714715-39714737 CTTGACCTCCTGGAGTGTTGGGG - Intronic
1126254018 15:46603559-46603581 CAGAACCACCTGGAGTTATGTGG - Intergenic
1129607424 15:77031677-77031699 CAGGACACCCTGGAGATGTGGGG - Intronic
1130199379 15:81810775-81810797 CTGGACCAGCAGGAGCTTTGTGG - Intergenic
1130578612 15:85115363-85115385 GAGGACCACCTGGAGTTTCCAGG + Intronic
1131295147 15:91141363-91141385 CAGGAAGACTTGGAGTTTTCAGG + Intronic
1132203112 15:99968692-99968714 CCGGAGAACCTGGAGTTCTGGGG - Intergenic
1132622147 16:872875-872897 CAGAACCATCAGGAGCTTTGAGG + Intronic
1133407921 16:5540766-5540788 CAGAATCACCTGGAGCTTTTTGG + Intergenic
1136280402 16:29205386-29205408 TAGGAACACCTGGAGTTGTGTGG + Intergenic
1136771984 16:32848079-32848101 AAGGACCACCTGGCTTTTGGAGG - Intergenic
1136898626 16:34013442-34013464 AAGGACCACCTGGCTTTTGGAGG + Intergenic
1137249264 16:46730514-46730536 CGGGACCACCTGGAGAACTGGGG - Intronic
1138540338 16:57683964-57683986 CAGGGCCACGTGGATCTTTGGGG - Exonic
1140023761 16:71264431-71264453 CAGGACCACTTAGAGCCTTGGGG - Intergenic
1140521188 16:75583240-75583262 CAGCACCTCCTAGAGTTGTGTGG + Intergenic
1140614712 16:76648586-76648608 GAGGAGGAACTGGAGTTTTGGGG - Intergenic
1140892551 16:79297727-79297749 CAGGTACACATGGAGTTCTGTGG + Intergenic
1141264388 16:82482962-82482984 CAGGACCCCCAGGGGTGTTGGGG + Intergenic
1141610361 16:85177765-85177787 CAGAACCCCATGGCGTTTTGGGG - Intronic
1142084771 16:88171344-88171366 TAGGAACACCTGGAGTTCTGTGG + Intergenic
1142109770 16:88325124-88325146 CGGGACCACCTGGAGTGTGCAGG - Intergenic
1203074405 16_KI270728v1_random:1110168-1110190 AAGGACCACCTGGCTTTTGGAGG - Intergenic
1143594529 17:7906436-7906458 CTGGAGCACCTGGGGATTTGGGG + Intronic
1144410243 17:14993894-14993916 CAGGCCCCCATGGAATTTTGGGG - Intergenic
1146054411 17:29574007-29574029 CTGGTCCATCTGGAGTTTTGAGG - Exonic
1148798564 17:50209511-50209533 CAGGACCAACTGGGATTATGTGG - Intergenic
1149249712 17:54754492-54754514 AAGTACTACCTGGAGTTTTGAGG - Intergenic
1153873323 18:9341112-9341134 CAGGTCCACCTGGATTTAAGTGG + Intronic
1153990496 18:10394805-10394827 CAGAACAACATGGAGTTTGGCGG - Intergenic
1154041409 18:10859797-10859819 CAGGAGCAACTAGAGTTATGTGG - Intronic
1156001737 18:32392587-32392609 CATGACCCCCTGAAGTTCTGAGG + Intronic
1157477165 18:48030816-48030838 CAAGACCACCAGGAGGTGTGTGG - Intronic
1157618937 18:49004133-49004155 CAGGACCACCTGGAGGATTTGGG - Intergenic
1158110150 18:53931767-53931789 AAGGACCACCTGATGTTATGAGG - Intergenic
1159973882 18:74686357-74686379 CAGGAGCACCAGGAGTTATGGGG - Intronic
1160029392 18:75245378-75245400 CAGGAACCCCTGGATTTTTAAGG + Intronic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1167414513 19:49363037-49363059 CAGGACCACCGGGAGTTTATTGG + Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
925057304 2:865048-865070 CAGGGCCACCTGGTGGCTTGGGG - Intergenic
927208541 2:20624930-20624952 CCGGACCACCTGGACACTTGTGG - Intronic
928359513 2:30651713-30651735 CAGAACCACCTGGAGAGCTGTGG + Intergenic
928783600 2:34854584-34854606 GAGCACCACCTGGATTCTTGAGG + Intergenic
930466726 2:51762153-51762175 CAAGGCCAACTGCAGTTTTGAGG + Intergenic
930773963 2:55154708-55154730 CAGGAGCCAATGGAGTTTTGTGG + Intergenic
933920807 2:87042905-87042927 CATGACCACTTGGAGTTTGATGG - Intergenic
933930818 2:87150881-87150903 CATGACCACTTGGAGTTTGATGG + Intergenic
934002191 2:87726994-87727016 CATGACCACTTGGAGTTTGATGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936362303 2:111814561-111814583 CATGACCACTTGGAGTTTGATGG - Intronic
936673705 2:114689273-114689295 CAGGAACACATGGAATGTTGGGG - Intronic
937189966 2:120085772-120085794 CAGGACAAGCTGGAGGTATGAGG - Intronic
937956975 2:127427091-127427113 CAGGACCACCTGGAATGGGGTGG - Exonic
940250045 2:151665093-151665115 CACAACCATGTGGAGTTTTGTGG + Intronic
941292840 2:163697694-163697716 CATGACCAACTGGTGTGTTGTGG - Intronic
942643838 2:178089898-178089920 CAGGACTACGTGGAGCTTCGAGG - Intronic
942655590 2:178211298-178211320 CAGGACCTCCTTGACTTTTTTGG - Intronic
945662543 2:212704265-212704287 AAGTAACTCCTGGAGTTTTGGGG + Intergenic
946611762 2:221465995-221466017 CATGACCAGCTGGAGTTTCCGGG - Intronic
947169104 2:227293243-227293265 CTGGCCCACCTGGACATTTGGGG + Exonic
947269258 2:228315404-228315426 CAGGAGCACATCTAGTTTTGTGG - Intergenic
947967028 2:234290395-234290417 CAGGAACAGCAGGAGGTTTGAGG - Intergenic
948587361 2:239027815-239027837 CAGGACCTCCTGGAGTGCAGTGG - Intergenic
1170206907 20:13808231-13808253 AAGGAGCACCTGGATATTTGGGG + Intronic
1171242153 20:23580208-23580230 CAGGAACACCAGTAGTTTTTAGG + Intergenic
1174698354 20:52582806-52582828 CAGGATTACCTGGAGTTTCCTGG - Intergenic
1175157990 20:56986248-56986270 CAAGACCACTGGGAGCTTTGGGG - Intergenic
1175718777 20:61273038-61273060 GAGGACCACGTGCAGTTTGGGGG + Intronic
1175718797 20:61273115-61273137 GAGGACCATGTGCAGTTTTGGGG + Intronic
1176063806 20:63183818-63183840 CAGGCCCACCTGGACCTTGGTGG - Intergenic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1179334820 21:40440920-40440942 ATGGACCACCTGGAGCTTTGAGG + Intronic
1181024606 22:20120843-20120865 CAAGATGACCTGGAGTTTTTTGG + Intronic
1181728524 22:24827993-24828015 CCTGACCACCTGGACCTTTGTGG + Intronic
1182331587 22:29554952-29554974 CAGGGCCACCTGGTGTGTGGAGG - Exonic
950832381 3:15887595-15887617 CAGGGCCACTTGGAGCCTTGGGG + Intergenic
951255846 3:20448293-20448315 CATGACCATTTGGAGTTTGGTGG + Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG + Intronic
953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG + Intergenic
953154500 3:40356820-40356842 GAGCACCAGCTGGAGTTATGAGG + Intergenic
953230726 3:41062641-41062663 GAGCACCACCTGGTCTTTTGTGG + Intergenic
955522314 3:59786812-59786834 CAGGAACAGCTGGAGTATTGAGG - Intronic
956195769 3:66651806-66651828 CAGGAGCACATGGAGGTTGGGGG - Intergenic
956516522 3:70054737-70054759 CAGGACAACATGGAGTGATGAGG + Intergenic
961920122 3:130416791-130416813 CTGGAAGACCTGGACTTTTGGGG + Exonic
962201338 3:133403370-133403392 CAGGACCAGGAGGAGTTCTGTGG - Intronic
963051231 3:141145810-141145832 CAGGACAGCCTGGAGGTTTGTGG - Intronic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG + Exonic
965757191 3:172039550-172039572 CGGGACCACATGGGGATTTGGGG - Intergenic
969490718 4:7497853-7497875 GAGGACCAGCAGGAGCTTTGTGG + Intronic
971552305 4:27973245-27973267 CACGACCAGCTGGAGTTATTTGG - Intergenic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
973550912 4:52035409-52035431 CAGGATGACCTGGAGTTGTTAGG + Intronic
976239753 4:82942735-82942757 CAGGACCACCAGGAAGTTTTTGG - Intronic
979927960 4:126591379-126591401 CAGGACCACTAGGATTGTTGAGG - Intergenic
981003977 4:139856003-139856025 CAGGTCCATCTGGAGTCCTGAGG - Intronic
982334561 4:154219501-154219523 AAGGGCCATCTGGATTTTTGTGG - Intergenic
983512377 4:168622439-168622461 CAGGACAACCTGGGGATTTCTGG + Intronic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
986544440 5:8880074-8880096 GAGCACCACCTGGGCTTTTGGGG - Intergenic
990044564 5:51413649-51413671 CAGGTACACATGGAGTTTTCTGG - Intergenic
991260238 5:64659580-64659602 CTGGACCACATGGAGTTTCGGGG + Intergenic
991565810 5:68003171-68003193 CAGGCCCACCTAGGGTTTGGTGG + Intergenic
991621067 5:68545778-68545800 ACGGGCCACCTGGAGTGTTGAGG - Intergenic
993107191 5:83612582-83612604 CAGGGCCACCTAGAGCCTTGAGG + Intergenic
993548567 5:89244457-89244479 TAGGAGCACATGGAGTTTGGTGG + Intergenic
994517352 5:100787376-100787398 CAGGGCCACTTGGAGGGTTGGGG + Intergenic
994691172 5:103021401-103021423 CAGTACCACCTAGAATTTTTTGG - Intronic
995883871 5:116871149-116871171 CAGGGCTACCTGGAGCTCTGGGG + Intergenic
997727579 5:136134019-136134041 CCTGACCAGCTGGAGCTTTGGGG + Intronic
998314707 5:141172564-141172586 CAGCGCCACCTTGCGTTTTGTGG - Intergenic
1002944442 6:1747701-1747723 CAGGACCTCCAGTAGTTTTGTGG + Intronic
1006460267 6:34153993-34154015 CAGGACCACATGGGGTGTTTGGG + Intronic
1015038321 6:128685388-128685410 AAGTTCCACCTGGGGTTTTGGGG + Intergenic
1017063827 6:150510120-150510142 CAGCACCTTCTGGAGTTTTCAGG + Intergenic
1017407767 6:154138626-154138648 CAGGACCCCTTGGAGGTTAGAGG - Intronic
1020637855 7:10718046-10718068 CAGGAAGGCCTGGACTTTTGGGG - Intergenic
1020978005 7:15031852-15031874 CTTGATCACGTGGAGTTTTGAGG - Intergenic
1024580299 7:50795534-50795556 CAGGGGCATCTGGAGTTTGGGGG - Intergenic
1024714627 7:52062016-52062038 CTGGACCACATTGAGTTTTTGGG + Intergenic
1025694116 7:63766157-63766179 CAGGGCCACCGGGAGTTGGGCGG - Intergenic
1026905247 7:74059352-74059374 AAGGACCCCTTGGAGATTTGAGG - Intronic
1034227108 7:149492874-149492896 CAGGAACATCTGGAATCTTGGGG + Exonic
1034242300 7:149619939-149619961 CAGGAACATCTGGAATCTTGGGG + Intergenic
1035056419 7:156039511-156039533 CAGGACCACCTGGGGAAGTGGGG - Intergenic
1038462853 8:27730991-27731013 CAGGACCTCCTGGGCTTTGGGGG + Intergenic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1039928504 8:41961031-41961053 CAGGACCTGCTTGAGGTTTGTGG - Intronic
1043175208 8:77016554-77016576 TAGCACCACCTGGAGATGTGTGG - Intergenic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1048968897 8:139633414-139633436 GAGGACCTCCTGGAGCTGTGAGG + Intronic
1050052662 9:1619460-1619482 CAGTTCCACATGGAGTTGTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053176532 9:35929412-35929434 CAGGACATCCTGGAACTTTGGGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1186153829 X:6705395-6705417 CTGGAGAACCTGGAGTTCTGAGG + Intergenic
1187421002 X:19133642-19133664 GAGGGCCACTTGGAGTATTGAGG - Intergenic
1190110380 X:47585568-47585590 CATCACTACCTGCAGTTTTGTGG + Exonic
1190218442 X:48495482-48495504 CAGGACCACCTGGGGTGGGGTGG - Intergenic
1195640999 X:107174617-107174639 AAGGGCCAGCTGTAGTTTTGGGG - Intronic
1196412268 X:115432817-115432839 AAGGACCACCTGGATGTTTGAGG - Intergenic
1196563491 X:117177982-117178004 CATGACCATTTGGAGTTTTATGG - Intergenic
1198087084 X:133292033-133292055 CAAGACCACATGGAATTTGGGGG + Intergenic
1198512857 X:137371670-137371692 CAGGAGAACGTGAAGTTTTGGGG + Intergenic
1201305426 Y:12546004-12546026 CAAGAGAACCTTGAGTTTTGAGG - Intergenic
1201748382 Y:17405392-17405414 CAGGACCACCCGCAGTTATTTGG + Intergenic
1201980158 Y:19898607-19898629 CAGGGCCACCTGGGGTGTGGTGG + Intergenic