ID: 951604028

View in Genome Browser
Species Human (GRCh38)
Location 3:24411727-24411749
Sequence ATGGGGATGGAGAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1782
Summary {0: 1, 1: 0, 2: 8, 3: 214, 4: 1559}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951604016_951604028 15 Left 951604016 3:24411689-24411711 CCTGGGAACATTTTTTGGTTGTC 0: 1
1: 1
2: 4
3: 18
4: 203
Right 951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG 0: 1
1: 0
2: 8
3: 214
4: 1559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951604028 Original CRISPR ATGGGGATGGAGAAAGAGGA TGG Intronic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031187 1:374084-374106 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031202 1:374133-374155 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900051756 1:602333-602355 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
900270647 1:1785746-1785768 GTGGGGAGGGAGAGAGAGGGAGG - Exonic
900415528 1:2532797-2532819 AGGGGGAGGGAGGAAGAGGCGGG - Intergenic
900628828 1:3623190-3623212 AGAGGGAGGGAGAAAGAGGGAGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
900972737 1:6000506-6000528 TTTGGGATGGAGAGAGAGCATGG - Intronic
901146074 1:7065432-7065454 ATGGGGATGGGAATGGAGGAAGG + Intronic
901166049 1:7222415-7222437 AGAGGAAGGGAGAAAGAGGAGGG - Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901686189 1:10944839-10944861 ACAGGGATGGAGAAAGGGCAGGG + Intergenic
901839947 1:11947928-11947950 ATGGGAATGGAGGATGAGGGAGG - Intronic
902078718 1:13806557-13806579 GTGGGGATGGAGGAAGAGGTTGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902546526 1:17193867-17193889 GTGGGCATGGAGAATGTGGAGGG + Intergenic
902549668 1:17211877-17211899 ATGGGGATGGAATCAGAGAATGG + Intronic
902705414 1:18200886-18200908 ATGAGGAGGGATAATGAGGAGGG + Intronic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903270870 1:22187486-22187508 AAGGGGCTGGAGGAAGGGGAGGG - Intergenic
903292123 1:22320878-22320900 ATGGGGAATGAGGGAGAGGAGGG + Intergenic
903316954 1:22515583-22515605 ATGGTGATGGAGGCAGAGGTTGG - Intronic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903392181 1:22972426-22972448 GAGGGGCTGGAAAAAGAGGAGGG + Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903543596 1:24110223-24110245 GTGGGGATGGAAACAGAAGAGGG + Intronic
903589569 1:24444348-24444370 GGAGGGATGGAGAAAGGGGATGG + Intronic
903689574 1:25163074-25163096 ATGGGGAGGGATGAATAGGAAGG + Intergenic
903853286 1:26320938-26320960 CTGGGGCTGGAGAAGGATGATGG + Intergenic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904162954 1:28534947-28534969 ATGGGGATGGAGAAGTGGGCAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904308409 1:29606743-29606765 AAGGGGGTGGAGCAAGATGATGG - Intergenic
904355605 1:29936990-29937012 GTGGGGTTGGGGAAAGAGCACGG + Intergenic
904768538 1:32868783-32868805 GTGGTGATGGAGAAATAGAAAGG - Intronic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905108936 1:35580366-35580388 AAGGGGTTGGAGCAAGAGGAAGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905648621 1:39641399-39641421 ACGTGGATGGAGACAGAGCAGGG + Intergenic
905853821 1:41294022-41294044 TTGGAGATGGAGAAAAGGGAAGG + Intergenic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
906187377 1:43871854-43871876 ATGGGGTGGGAGGGAGAGGAGGG + Intronic
906187470 1:43872138-43872160 ATGGGGACTAACAAAGAGGATGG + Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906270095 1:44470781-44470803 AGGAGGATGCAGGAAGAGGACGG - Intronic
906287663 1:44598163-44598185 ATGGGGAGGGGGAAACAGGGAGG + Intronic
906314066 1:44775176-44775198 ATGGGGATTGAGGGAGAGGGCGG - Intergenic
906509595 1:46403417-46403439 AAGGGGATGGAGACAGGAGAGGG - Intronic
906525616 1:46491481-46491503 AGGGCGTTGGGGAAAGAGGAGGG + Intergenic
906560050 1:46749650-46749672 ATGAGGTTGGAGATAGAAGAAGG + Intergenic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
906958408 1:50397160-50397182 CTGGTGTTGAAGAAAGAGGAAGG - Intergenic
907335674 1:53697941-53697963 ATTGGGATGGGGACAGAGCAGGG + Intronic
907359747 1:53904894-53904916 AGGTGGAAGGAGGAAGAGGAGGG + Intronic
907379777 1:54076927-54076949 AGGGGGATGGGGAACGTGGATGG + Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907392780 1:54169099-54169121 TTGGGGAGGGAGAAAGAAGGGGG + Intronic
907535456 1:55151467-55151489 AAGGGGAGGAAGTAAGAGGAAGG + Intronic
908313544 1:62909788-62909810 AAGGGAAGGGGGAAAGAGGAAGG + Intergenic
908333475 1:63096041-63096063 ATGGGGATGGACAATGGGAATGG + Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909498281 1:76304367-76304389 GGGTGGATGGAGAAAGAAGATGG - Intronic
910105517 1:83627603-83627625 ATGGGTATAGAGAAAGGGGAAGG + Intergenic
910332973 1:86097450-86097472 AGGAGGAGGGAGGAAGAGGAGGG - Intronic
910336611 1:86139220-86139242 AGAGGGATGGAGAAAGAGTGAGG + Intronic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910547955 1:88440609-88440631 AGGGGGAGAGAGAGAGAGGAAGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910771978 1:90840004-90840026 ATAGGGAAGGAGAGAGAGGCTGG - Intergenic
910969117 1:92836689-92836711 AAGTGCATGGGGAAAGAGGATGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911132555 1:94404638-94404660 AAGGGGATGCAGAAATAGAATGG - Intergenic
911234886 1:95401832-95401854 ATGGGAATGGAGAGAGAGAGGGG - Intergenic
911387329 1:97193710-97193732 ATGAGGAGGGAGACAGAGGCAGG - Intronic
911423599 1:97678089-97678111 ACCGGGTTGGAGAAAGAGGATGG + Intronic
911664064 1:100534424-100534446 ACAGAGATGGAGAAAGATGAAGG - Intergenic
911745103 1:101433155-101433177 ATGAGGAGTGAGAAAGAGGGAGG + Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912040353 1:105382852-105382874 ATGGAGAGGGAGAAAGAAAAAGG - Intergenic
912400773 1:109389964-109389986 TGGGGGATGGAAAGAGAGGAGGG - Intronic
912490595 1:110060681-110060703 CTGGGAATGGAAAAAGAGGTGGG + Exonic
912512217 1:110197367-110197389 ATGGTGATGGGGGAAGAGGGAGG + Intronic
912956248 1:114155677-114155699 AGGGGGAGGGAGAAATAGCAGGG - Intergenic
913097673 1:115534835-115534857 AAGGGGATGGAGTAGGAAGAAGG - Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913576847 1:120183767-120183789 GTAGTGATGGAGTAAGAGGATGG - Intergenic
914558756 1:148795202-148795224 GTAGTGATGGAGTAAGAGGATGG - Intergenic
914614077 1:149335028-149335050 GTAGTGATGGAGTAAGAGGATGG + Intergenic
914883492 1:151565993-151566015 AAAGGGAGGGAGAAAAAGGAAGG - Intronic
914918626 1:151833065-151833087 ATGAGTAGTGAGAAAGAGGAGGG + Intergenic
914960105 1:152197504-152197526 AGGGGGAAGGGGAAAAAGGAAGG - Intergenic
915243729 1:154541856-154541878 GTGAGGATGGAGAGAGTGGACGG + Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
915551673 1:156638840-156638862 CAGGGGAGGGAGAAAGAGGGAGG - Intergenic
915622710 1:157095667-157095689 GTGGGGGTGGAGAAACAGGGAGG + Intronic
915786818 1:158622718-158622740 AGGTGGATGGAACAAGAGGATGG - Intronic
915913877 1:159929981-159930003 ATGGGGATGGGGTACCAGGAGGG + Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916732544 1:167579645-167579667 ATGGGGGTGGAGGAAAAGGGAGG + Intergenic
916842920 1:168618282-168618304 ATGGGGATTGAGAGAGAATAAGG + Intergenic
917193760 1:172445441-172445463 ATGTGGGGTGAGAAAGAGGATGG - Intronic
918069509 1:181124582-181124604 AGGAGGAGGGAGGAAGAGGAAGG - Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918442715 1:184584073-184584095 AGGGGGAAGGAGAAAGTGGTGGG - Intronic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918481722 1:184985305-184985327 ATTGGGATGGAGAATGATGGAGG + Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919477197 1:198043479-198043501 ATGGTGATGGTGAAAGAGTTAGG + Intergenic
919525929 1:198650379-198650401 GGGAGGATGGAGAAAGGGGATGG + Intronic
919878826 1:201889102-201889124 ATGGGGGCGGAGGAAGGGGAGGG + Intronic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920034671 1:203058231-203058253 AGGAGGTTGGGGAAAGAGGAAGG + Intronic
920278905 1:204828859-204828881 CAGGGGATGGAGACAGACGAGGG - Intronic
920413139 1:205778164-205778186 ATGGCAATGTAGTAAGAGGAAGG - Intergenic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920706294 1:208252977-208252999 ATGGGGGTGGGGAGAGGGGAGGG - Intergenic
920773007 1:208907344-208907366 CTAGGGATGGAGAGAGAGGCAGG + Intergenic
920940599 1:210478477-210478499 ATTGGGATGGTGAAATAGGAAGG + Intronic
921080057 1:211732074-211732096 ATGGGGAAAGAGACAGAGGGAGG - Intergenic
921129695 1:212209052-212209074 CTGGGAATGGAGACAGAGGAGGG + Intergenic
921188807 1:212692163-212692185 TTGGAGATGGAGAACAAGGAGGG + Intronic
921412918 1:214855469-214855491 TGGGGGGTGGAGAAAGAAGAGGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922244773 1:223785495-223785517 ATGGGAATGAAGAAAGACGTAGG + Intronic
922360812 1:224819684-224819706 ATGGCCAGGGAGAAAGAGGCAGG - Intergenic
922542316 1:226428702-226428724 CTGGGGAGGGAGAGAAAGGATGG - Intergenic
922722598 1:227906386-227906408 AGGAGGATGGAGTAGGAGGAGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923114476 1:230922217-230922239 AAGGGCATGGAGCTAGAGGAAGG - Intronic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923258529 1:232243716-232243738 ATGGGAATGCAGAAAGAGAGGGG - Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923334885 1:232959518-232959540 ATGGGAATGAAGAAAGGAGAAGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
923848154 1:237761001-237761023 CTTGGGATGGTGACAGAGGAAGG + Exonic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924337608 1:242999266-242999288 CGTGGGATGGAGAGAGAGGAGGG - Intergenic
924705762 1:246500687-246500709 ATGGGGACGGGGATAGAGGCTGG - Intronic
1062899740 10:1133978-1134000 AGTAGGATGGAGAAAGAGGATGG + Intergenic
1063153408 10:3356495-3356517 ATGGGGCTAGAGAACGAGGAAGG - Intergenic
1063505437 10:6593811-6593833 ATGGGGAGGGAGATAGGGAAAGG - Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1063997051 10:11629278-11629300 AAAGAGATGGAGGAAGAGGAAGG - Intergenic
1064115709 10:12575583-12575605 ATTGGGATGCAGAAAGAAAATGG + Intronic
1064214483 10:13388092-13388114 AGGGAGATGGTGGAAGAGGAGGG + Intergenic
1064328138 10:14369935-14369957 ATGGGGCTTGACAAAGAGGTAGG - Intronic
1064332027 10:14402949-14402971 ATGGAGATGGGGACAGAGGGTGG + Intronic
1064337380 10:14456258-14456280 ATGGGGTTGGAGAGAGAGCCAGG - Intronic
1064921337 10:20522291-20522313 AAGGTTATGGAGAAAAAGGAAGG - Intergenic
1065229590 10:23583644-23583666 ATGGGTGTGGGGCAAGAGGAGGG - Intergenic
1065431108 10:25656861-25656883 ATGGAGATAGAGTAAAAGGATGG - Intergenic
1065824337 10:29556264-29556286 ATGGGGTGGGAGAAAGAGAGAGG + Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066563145 10:36691973-36691995 AGGAGGATGGAGAAAGGGAAGGG - Intergenic
1066704278 10:38160734-38160756 ATGAGCATGCAGAAAGAGGTGGG - Intergenic
1066986344 10:42471124-42471146 ATGAGCATGCAGAAAGAGGTGGG + Intergenic
1066995929 10:42563031-42563053 ATGAGGGTGGAGTAGGAGGAGGG - Intergenic
1067056950 10:43058060-43058082 TGGGGGATGGAGAAGGAGGGAGG - Intergenic
1067063883 10:43092927-43092949 AGGGGAAGGGAGTAAGAGGACGG - Intronic
1067162912 10:43842379-43842401 ATGGGGCTGGAGGAGTAGGAGGG + Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067742943 10:48910259-48910281 CTGGGGATGGAGACACAAGAAGG + Intronic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068523074 10:58098928-58098950 ATGGGAGGGGAAAAAGAGGAGGG - Intergenic
1068788035 10:60998622-60998644 AAGGGGGTGGAAAAAGGGGAAGG + Intronic
1069038630 10:63671618-63671640 TGGGGGATGGAGACAGAGGAGGG - Intergenic
1069111321 10:64450751-64450773 ATTGGGATGGGGAAAGGGGCTGG + Intergenic
1069994713 10:72335279-72335301 GGAGGGATGGAGAAAGGGGAGGG + Exonic
1070156166 10:73836862-73836884 ATGGGACTGGGGCAAGAGGAGGG - Intronic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070228892 10:74542605-74542627 ATGGGGAATGAGGAAGATGAGGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070278919 10:75034746-75034768 AAGGGGATGGAGAAGGTAGAAGG - Intergenic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070448695 10:76535303-76535325 AGGGGGTTGGAAGAAGAGGAAGG + Intronic
1070491505 10:76981161-76981183 TTGGGGAAGGAGAGAGAGTATGG - Intronic
1070580957 10:77718926-77718948 CTGAGGATGGAAAAAGAGAATGG + Intergenic
1070692384 10:78536768-78536790 ATGAGTATGGAGAAAGAAGAGGG - Intergenic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1070939043 10:80327006-80327028 ATGGGGGTGGAGGACAAGGAAGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071219564 10:83448368-83448390 ATGAGGATGGAGAAAAATGTTGG + Intergenic
1071231100 10:83586756-83586778 ATGGGGATGGAGGAAGAAATTGG - Intergenic
1071284124 10:84128661-84128683 CTGGGGTTGTAGAAAGAGGAAGG - Intergenic
1071488707 10:86121381-86121403 ATGGCGATGGAGATAAATGATGG - Intronic
1071741580 10:88364433-88364455 CTGGGGATGTAAAATGAGGATGG - Intronic
1071752553 10:88496893-88496915 ATGGAGATGGTCAAAGAGTAGGG + Intronic
1071923548 10:90378480-90378502 TTGGGGAGGGAGAAACTGGATGG - Intergenic
1072188209 10:93061529-93061551 ATGGGCATTGAGACTGAGGAGGG - Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073529549 10:104218738-104218760 ATGGGGAGGGAAAAGGATGAGGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073927248 10:108531303-108531325 ATGGGGTGGGGGAAAGGGGAGGG + Intergenic
1074764539 10:116691104-116691126 ATAGGGATGAAGGAAGAGGGTGG - Intronic
1075153177 10:119953518-119953540 GGGGGGAGGGAGGAAGAGGAAGG - Intergenic
1075153197 10:119953581-119953603 GGGGGGAGGGAGGAAGAGGAAGG - Intergenic
1075153217 10:119953644-119953666 GGGGGGAGGGAGGAAGAGGAAGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075915311 10:126161630-126161652 ATGGTGCTGGAGAAAGATGTGGG - Intronic
1076053382 10:127352320-127352342 GTGGGGAGGGGCAAAGAGGATGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076192215 10:128490855-128490877 CTGGGGATGGAGACAGAGATTGG - Intergenic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1076433591 10:130424498-130424520 GTGAGGATGGAGACAGAGGCTGG + Intergenic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1076486448 10:130822146-130822168 ATAGGGAGGGAGGGAGAGGAAGG + Intergenic
1076621590 10:131792506-131792528 AGGGGTGTGGAGAAAGAGAATGG - Intergenic
1076831842 10:132999338-132999360 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831855 10:132999382-132999404 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831881 10:132999470-132999492 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831907 10:132999558-132999580 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077166469 11:1142017-1142039 ATGGGAGGAGAGAAAGAGGATGG + Intergenic
1077595718 11:3529726-3529748 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1078090822 11:8263337-8263359 ATGGTGCTGGACAAGGAGGACGG - Exonic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078576653 11:12508556-12508578 ATGGGGGTGGGGAAAGGGGTTGG - Intronic
1079124446 11:17708822-17708844 ATGTGGATGGAGTCAGAGGATGG + Intergenic
1079131066 11:17747299-17747321 CTGGGGATGGAGGAAGAGCAGGG - Intronic
1079279748 11:19076563-19076585 ATAGGGATGAGGAAAGTGGATGG + Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079445544 11:20553568-20553590 AGGGGGAGGGAGGAAGAGGGAGG - Intergenic
1079601541 11:22316784-22316806 ATGGGGAGAGAGACAGAGGTGGG - Intergenic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080142674 11:28941591-28941613 AGGGGGCAAGAGAAAGAGGATGG + Intergenic
1080652828 11:34236162-34236184 ACAGGGCTGGAGAAAGAGGAGGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080806926 11:35662604-35662626 AGGAGGAGGGAGAAGGAGGATGG - Intergenic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081121907 11:39277286-39277308 ATGGGGCTGTGGAAATAGGAAGG - Intergenic
1081194946 11:40150110-40150132 ATGGGGGTAAAGAAAGAGAATGG - Intronic
1081492721 11:43580169-43580191 AGCGGGATGGAGGAAGAGGGAGG + Intronic
1081533444 11:43981067-43981089 AAGGGGATGGGGAAACAAGATGG + Intergenic
1081574956 11:44313305-44313327 ATGGAGGTGGAGAAAGAAGCGGG - Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081719494 11:45277537-45277559 ATGAGGCTGGGGAAATAGGAAGG - Intronic
1081797685 11:45832787-45832809 ATGGAAATGGAGGAACAGGATGG - Intergenic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1082932944 11:58628042-58628064 AAGGGGATTGGTAAAGAGGAAGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083181309 11:60987595-60987617 GGGGGTATGGAGAAAGAGGTGGG + Intronic
1083345949 11:61992187-61992209 GTGGGGGTGGAGAAAGAAGATGG - Intergenic
1083556906 11:63636842-63636864 GTGGGGAAGGAGAAAAATGAAGG - Intronic
1083583656 11:63840622-63840644 GTGAGGGTGGAGAAACAGGAAGG - Intronic
1084038745 11:66529710-66529732 GTGGGGAGGGTGCAAGAGGAGGG - Intronic
1084163792 11:67365644-67365666 AGGGTGATGGGGAAGGAGGAGGG + Intronic
1084251613 11:67903707-67903729 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
1084485348 11:69444843-69444865 ATGTGGCTGGAGAGAGTGGACGG + Intergenic
1084782203 11:71417635-71417657 AGGAGGAGGGAGAGAGAGGAAGG + Intergenic
1084821228 11:71692323-71692345 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
1084953191 11:72677989-72678011 GTGGGGATGGAGGGAGTGGATGG - Intergenic
1085190242 11:74614372-74614394 TTGGGGATGGAGAAGTATGAAGG + Intronic
1085196239 11:74673554-74673576 AGGAGGGTGGAGGAAGAGGAGGG - Intergenic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085297509 11:75439383-75439405 AGGGGGAGGGGGAGAGAGGAGGG + Intronic
1085707440 11:78799291-78799313 TTGGGGCTGGGGAAAGGGGATGG + Intronic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1086885822 11:92204693-92204715 GAGGGGGTGGAAAAAGAGGAGGG - Intergenic
1087026992 11:93659917-93659939 AAAGGGATGGAGTAGGAGGAAGG - Intergenic
1087105368 11:94402158-94402180 ATGGGGAAGGAAAAACAGCATGG - Intergenic
1087185449 11:95187910-95187932 GTGAGGATGGAGAAAGTGGGTGG - Intronic
1087268028 11:96082435-96082457 AAGGGGATGGAGAGAGTGAAGGG + Intronic
1087494240 11:98868792-98868814 ATAGGGATGAAGAAATATGAGGG - Intergenic
1087569634 11:99909038-99909060 ATTCAGCTGGAGAAAGAGGAAGG - Intronic
1087875287 11:103348444-103348466 ATAGGGCAGAAGAAAGAGGAGGG - Intronic
1088570749 11:111221476-111221498 CTGGGGATGGAGCAAGTGGTTGG - Intergenic
1088582748 11:111331371-111331393 ATGGGGCCATAGAAAGAGGAGGG - Intergenic
1088970998 11:114774710-114774732 ATGGGGAAGGAAAAAGGGAAAGG - Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089116312 11:116097857-116097879 TTGGGGTTGGGGAAAGAGGAGGG + Intergenic
1089134114 11:116235568-116235590 ATAGGGATGGGGAGAGAGGCTGG - Intergenic
1089230678 11:116972453-116972475 CTGGGGATGAAGAAAGAAGTTGG - Intronic
1089291286 11:117439208-117439230 ACAGGGATGGAGAAAGGGTAGGG - Intronic
1089307372 11:117535167-117535189 ATGGGGATGGTGTGGGAGGAGGG + Intronic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089604614 11:119634734-119634756 AAGGGGATGGGGAAAGAAGGAGG - Intronic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1089717058 11:120370787-120370809 ATGGGAAGGAAGAAACAGGAAGG - Intronic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090439825 11:126716203-126716225 AGGCGGAGGAAGAAAGAGGAAGG + Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1091107059 11:132932490-132932512 AGGGGGATGGAGGAAGAGAGAGG - Intronic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091416840 12:295247-295269 AGGGGAAAGGAGAAAGGGGAAGG + Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092137696 12:6161127-6161149 ATGGGGTGGGAGAGAGAGAAGGG + Intergenic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093156651 12:15693894-15693916 ATGGAGGTGGGGCAAGAGGAGGG + Intronic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093216887 12:16372785-16372807 AGGTGGATGGATAAAGAAGATGG + Intronic
1093733100 12:22588315-22588337 TTTAGGCTGGAGAAAGAGGAAGG + Intergenic
1093781615 12:23143612-23143634 ATGGATGTGGAGAAATAGGAAGG - Intergenic
1093822857 12:23643138-23643160 ATGGGGATGGAGAGTGAGGCAGG + Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094365213 12:29672638-29672660 ATGAGGATGGGGTGAGAGGAGGG - Intronic
1095931472 12:47630131-47630153 AGGGGGTTGGGGAAAGAGGAGGG + Intergenic
1096199077 12:49668446-49668468 ATGGGGTTTGGGAAAGAGGAGGG - Intronic
1096320635 12:50609554-50609576 TTGGGAAGGGAGAAAGAGAAGGG + Intronic
1096542850 12:52317841-52317863 ATGTGGCAGGACAAAGAGGATGG + Intronic
1096655856 12:53091746-53091768 ATAGGGATGAAGAGAGGGGATGG - Intergenic
1096793915 12:54062073-54062095 GGAGGGAGGGAGAAAGAGGAGGG - Intergenic
1097022390 12:56029550-56029572 AAGTGGATGGAGAAAGTAGAGGG - Intronic
1097035254 12:56119604-56119626 CTGGGGGTGGAGAGAGGGGAGGG + Intronic
1097045377 12:56183931-56183953 CTGGGGATAGAGGAAGAGAAGGG + Intronic
1097203532 12:57300445-57300467 ATGGGGTTGAAGAGAGAAGAGGG - Intronic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097705235 12:62861636-62861658 ATGGTTATAGAGAAAGAGGCAGG + Intronic
1097965253 12:65572458-65572480 ATGGGGAGGGAGAAACAGAATGG - Intergenic
1098185379 12:67890820-67890842 GTGAGGATGGGGCAAGAGGAGGG + Intergenic
1098188083 12:67919806-67919828 ATGGTCTTGGAGAAAGAAGAAGG - Intergenic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1098542265 12:71670068-71670090 AGGGGGATGGGGACAGAAGATGG + Intronic
1099011701 12:77298885-77298907 GTGGGGATAGAGATAGTGGAAGG - Intergenic
1099552997 12:84071893-84071915 ATCGGGATTATGAAAGAGGATGG - Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099836656 12:87915027-87915049 ATGGGCCTGGAAAGAGAGGAGGG + Intergenic
1100863308 12:98830122-98830144 AAGGGGAAGGAAAAAGAGCAGGG + Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1100987292 12:100214809-100214831 ATGGGAATTGAGATAGATGATGG + Intronic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101580237 12:106036305-106036327 ATGGGGTGGGAGAGAAAGGAGGG + Intergenic
1101681227 12:106967771-106967793 GTGAGGATGGATACAGAGGAAGG + Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101877839 12:108607173-108607195 AGGGGGAGAGAGAAAGAGGAGGG - Intergenic
1101998480 12:109541824-109541846 ATGGGGATGGAGGCAGAGATGGG - Intergenic
1102167910 12:110820901-110820923 AAGGGGATGGAGAGAGGGAAGGG - Intergenic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102511083 12:113415985-113416007 CAGGGGCTGGAGAAAGTGGAGGG - Intronic
1102598820 12:114013120-114013142 AGGGAGATGGAGAGAGGGGAGGG + Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102808087 12:115799674-115799696 TTGGGGGGGGAGAAAGAAGAAGG + Intergenic
1102816748 12:115872149-115872171 ATGGAGCTGGAGAAAGATGTAGG - Intergenic
1103156073 12:118686023-118686045 AGGGGGAAGGAGGAAGAGAATGG - Intergenic
1103206917 12:119136956-119136978 GAGGAGATGGAGAAAGAGAAGGG - Intronic
1103572581 12:121854892-121854914 CTGGGGCTGGAGAAACTGGAGGG - Intronic
1103948728 12:124540686-124540708 ATGGGGGTGGAGATGGAGGGGGG + Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104001695 12:124864177-124864199 AAGGGGTAGGAGAAAGGGGAAGG - Intronic
1104237181 12:126950455-126950477 GTGGGGCTTGAGAAAGAGCATGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104357913 12:128104490-128104512 ATGCAGGTGGAGATAGAGGAAGG - Intergenic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1104874162 12:132021418-132021440 ATGGGGCTGGGGAAAGACAAAGG - Intronic
1104950994 12:132440039-132440061 ATGGGGATGGAGAACGAGGTTGG - Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105278560 13:18950114-18950136 ATGGTGATGGGGACAGAGGTGGG - Intergenic
1105287220 13:19014227-19014249 GTGAGGATGGAGAGAGAGGCAGG - Intergenic
1105418765 13:20234694-20234716 GTGGGGGTGGAGAGAGAGGAAGG + Intergenic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105650249 13:22369551-22369573 AATGGGATGGAGAGAAAGGAGGG + Intergenic
1105972286 13:25440309-25440331 AGGGGAAGGAAGAAAGAGGAAGG - Intronic
1106331834 13:28746464-28746486 ATGGTGATGGAGAAAGGAAAGGG + Intergenic
1106453951 13:29910415-29910437 ATGAGGTTGGAGAAAGAACATGG - Intergenic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106788039 13:33126607-33126629 CTGGGGTTGGAGGAAAAGGAAGG + Intronic
1106940629 13:34775028-34775050 ATGGGGAAAGAGAGAGAGTAAGG + Intergenic
1106982245 13:35301330-35301352 GGGGGGTTGGGGAAAGAGGAGGG - Intronic
1107137477 13:36959858-36959880 AAGGAAATGGAGATAGAGGATGG + Intronic
1107252523 13:38381054-38381076 ATCGGGATGGAGAATGAGGCTGG + Intergenic
1107359483 13:39603236-39603258 AGGGGACTGGAGAAAGAGGAGGG - Intronic
1107445914 13:40470400-40470422 AAAGGGAGAGAGAAAGAGGAAGG - Intergenic
1107448721 13:40489901-40489923 ACGGGGAGGGAGAGAGAGCATGG - Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1107946302 13:45420008-45420030 AGGGGAAAGGAGAAAGAGGGAGG + Intergenic
1108104850 13:46997833-46997855 ATGAGGAGCTAGAAAGAGGACGG + Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108575256 13:51784869-51784891 ATGGGGATTGAGAAATGGAAGGG - Intronic
1108671199 13:52690807-52690829 AATGGAATGGAGAAAGAGGATGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108812691 13:54248192-54248214 ATGGGGTTGGGGGAAGAGGGAGG + Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110271477 13:73595833-73595855 AGGGAGATTGAGAAATAGGAAGG + Intergenic
1110286448 13:73755139-73755161 ATAGGTATGGAGAAAGAAAAGGG - Intronic
1110351867 13:74518187-74518209 ATGGTGATGAAGAAAGAAGGAGG - Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110904404 13:80867373-80867395 ATGGAGATGGAAAAAAAGGCTGG - Intergenic
1110939751 13:81334834-81334856 AGGGGGAGAGAGAGAGAGGAAGG - Intergenic
1110950461 13:81482759-81482781 ATGAGGATGCAGAAAGGAGAAGG - Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111696407 13:91630394-91630416 ATGGGGAGGGAAAAATAAGACGG - Intronic
1111741147 13:92207179-92207201 ATGGGAAAGGAAAGAGAGGAGGG - Intronic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1112241128 13:97682284-97682306 AAGGGGGTGGAGAAAGATGAAGG + Intergenic
1112505267 13:99971192-99971214 AAGGGGTGGGAGGAAGAGGAGGG + Exonic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112886317 13:104176948-104176970 AGGGGCATGGACACAGAGGAAGG - Intergenic
1113159591 13:107364972-107364994 AGGGGGATGGGGAAGGGGGAGGG - Intronic
1113159605 13:107364996-107365018 AGGGAGGTGGAGGAAGAGGAGGG - Intronic
1113179792 13:107612097-107612119 AGGGGGAGGGAGGAAGGGGAGGG + Intronic
1113502867 13:110792261-110792283 ATGCACATGGAGAGAGAGGAAGG + Intergenic
1113525730 13:110973772-110973794 ATGGAGTTGGGGAAAGAGGGTGG + Intergenic
1113615182 13:111675436-111675458 ATGAGGATGGAGACAGAGATCGG - Intergenic
1113620649 13:111760349-111760371 ATGAGGATGGAGACAGAGATCGG - Intergenic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1114527718 14:23376986-23377008 ATGGGGAGGGGCAGAGAGGAAGG - Exonic
1114547218 14:23512035-23512057 ATTGGGATGGGGGAGGAGGAAGG - Intergenic
1114549881 14:23526560-23526582 ATGGGGCTGGAGAAGGGGGTTGG + Exonic
1114649760 14:24277051-24277073 GTGGGCATGGAGAGTGAGGATGG + Intergenic
1114654916 14:24310318-24310340 ATGGGGCTGGACAAAGAAGGAGG + Intronic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1114665123 14:24373063-24373085 ATGGGAATGGTGAAAGATAAAGG - Intronic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115315787 14:32023604-32023626 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1115500053 14:34041691-34041713 ATGGATATGGTGACAGAGGAAGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116690024 14:48093889-48093911 ATGGGGCAGGAGAAAGAGATAGG + Intergenic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1116909819 14:50448917-50448939 TGGGGGAGGGAGAAAGAAGAGGG + Intronic
1116984903 14:51208029-51208051 GTTGGGATAGAGGAAGAGGAGGG - Intergenic
1117062823 14:51980594-51980616 TTAGGCAGGGAGAAAGAGGAAGG + Intergenic
1117149771 14:52873506-52873528 AGGGGGAAGGAGAAAGGGTAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117297121 14:54390827-54390849 ATTGGGATGGAGACAAGGGATGG - Intergenic
1117460530 14:55940440-55940462 TTAGGGATGGAGAAATAGGAGGG + Intergenic
1117527526 14:56624731-56624753 CTGGCTATGGAGACAGAGGAGGG + Intronic
1117582987 14:57171698-57171720 AAGGGGAAGGAGAAAAAGTAAGG + Intergenic
1117797243 14:59407023-59407045 ATGGTGATGAATAAAAAGGAAGG + Intergenic
1118259879 14:64236672-64236694 ATCAGGGTAGAGAAAGAGGAAGG - Intronic
1118322368 14:64760664-64760686 TGGGGGATGGAGAAAAATGAAGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118763150 14:68892820-68892842 ATGGTGGTGGAGAAGGTGGAGGG + Intronic
1118979099 14:70701695-70701717 AGGGGAAAGGAGGAAGAGGAGGG + Intergenic
1118998016 14:70854891-70854913 ATGAGGATTGAGAAGGATGATGG + Intergenic
1119000062 14:70873572-70873594 ATGGGGAGCAAGAAAAAGGATGG - Intergenic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119476910 14:74935563-74935585 TTGAGGATGGAGAGAGAGAAGGG - Intergenic
1119577891 14:75744321-75744343 ATGCGAGTGGAGAAATAGGAAGG - Intronic
1119598583 14:75958896-75958918 ATGGGGATAGAGGAAAGGGATGG - Exonic
1119770234 14:77216063-77216085 AGGGAGATAGAGAGAGAGGAAGG + Intronic
1119864587 14:77962721-77962743 AATGGGATGGAGAGACAGGAGGG - Intergenic
1119891757 14:78188080-78188102 TTAGAGATGGAGAAACAGGATGG + Intergenic
1120094476 14:80373351-80373373 GTGGGGATAGAAAAAAAGGAAGG - Intronic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120717254 14:87853174-87853196 ATTGGGATGGAGAAAGAGTATGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121550520 14:94796150-94796172 AGAGGGATGGTCAAAGAGGAAGG + Intergenic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121727933 14:96166512-96166534 GTGGGGAAGGAGGAAGAGAAGGG + Intergenic
1121861700 14:97324774-97324796 ATGGGGGTTGAGGAAGGGGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122038515 14:98965328-98965350 ATGGGGATGCAGAGAGAGCTGGG - Intergenic
1122281016 14:100622439-100622461 AGGAGGAGGGGGAAAGAGGAAGG - Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122890218 14:104728795-104728817 CTGGGGATGGACACAGAGGCAGG + Intronic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123587472 15:21772747-21772769 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1123624110 15:22215312-22215334 GGGGGGATGGGGAGAGAGGAGGG + Intergenic
1124067763 15:26362012-26362034 ATGGGGATTGAGAGAGAGGGAGG + Intergenic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1124239682 15:28019209-28019231 AAAGGGATGGGGAAAGAGGGAGG + Intronic
1124866675 15:33499174-33499196 AAGGGGAGGGAGAGAGAGGGAGG - Intronic
1124899078 15:33805908-33805930 AAGGGGAGGGTGAAAGGGGAGGG - Intronic
1125162774 15:36665548-36665570 GTTAGGATAGAGAAAGAGGATGG + Intronic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125741375 15:41967098-41967120 ATGGGGATCCAAGAAGAGGAAGG - Intronic
1125752799 15:42041488-42041510 CTGGGGTTGGGGAAAGAGGTTGG + Intronic
1126592491 15:50354562-50354584 AGTGGGCGGGAGAAAGAGGAAGG - Intronic
1127262980 15:57339213-57339235 AGGGGAAGGGAGAAAGGGGAAGG + Intergenic
1127532140 15:59853784-59853806 ATGGGGAAGGACAGAGAGGAGGG - Intergenic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1127686874 15:61354605-61354627 ATGGGGACGGAGAAAAAGAAAGG - Intergenic
1127933136 15:63610865-63610887 GTGGGGATGGAGACAGAGGGAGG + Intronic
1127967915 15:63937560-63937582 GTGGGGAGGGAGCCAGAGGAGGG - Intronic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128578592 15:68792971-68792993 CTGAGGTTGGATAAAGAGGAGGG - Intronic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1128727926 15:70001471-70001493 AGAGGGAGGGAGGAAGAGGAAGG + Intergenic
1128830594 15:70764404-70764426 AAGAGGATGAAGAAACAGGAAGG + Intergenic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129146045 15:73648458-73648480 AGAGGGATGGAGAAAGTGGAGGG - Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129590447 15:76910112-76910134 AGGGGGAGGGAGAAAGAGAGAGG - Intergenic
1130101718 15:80899640-80899662 ATGGGGCTCGAGAGAGAGGGAGG + Intronic
1130251225 15:82301429-82301451 GTGGGGAGGGAGCAAGAGGGAGG - Intergenic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130367677 15:83254788-83254810 AAGGGGATGGAGAAGTAGCAGGG + Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130663481 15:85850119-85850141 ACAGGGATGGGGGAAGAGGAGGG - Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131639104 15:94270589-94270611 GGGGAGATGGAGAAAGAGCAAGG - Intronic
1131662879 15:94537649-94537671 AGAGGGATGGAGAAAGAGAGAGG + Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1131828995 15:96342453-96342475 TTGGGGATGGAGATAGAGGTGGG - Intergenic
1132155014 15:99489541-99489563 ATGAGGATGGAGGCAGAGGTCGG - Intergenic
1132568001 16:631940-631962 AAGAGGATGGAAAAAGTGGATGG - Intronic
1132622681 16:875214-875236 GTGGGGATGCTGAAAGGGGAGGG - Intronic
1132761756 16:1511933-1511955 ACAGGGAGGGAGAGAGAGGAAGG + Intronic
1133325752 16:4941178-4941200 ATGGGGAACGAGAAAGGAGAGGG - Intronic
1133355912 16:5136718-5136740 AGAGAGATGGAGAAAGAGAAAGG - Intergenic
1133376406 16:5291066-5291088 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1133886004 16:9828191-9828213 ACAGGGATGGAGCAAGAGGAAGG + Intronic
1134074931 16:11284004-11284026 AGCAGGAAGGAGAAAGAGGAGGG + Intronic
1134295235 16:12939686-12939708 CAGGTGATGGGGAAAGAGGAAGG - Intronic
1134329314 16:13235859-13235881 ATGGGGGTAGAGAATGAGGGAGG + Exonic
1134584336 16:15397166-15397188 AAGGTGATGGAGAAAGGAGAGGG + Intronic
1134692065 16:16197613-16197635 AGGGGGAAGGAGGAAAAGGAAGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135161589 16:20101405-20101427 GAGGTGATAGAGAAAGAGGAAGG + Intergenic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135465404 16:22680553-22680575 GTGGGGAGGGAGGCAGAGGATGG - Intergenic
1135660687 16:24293981-24294003 AAGTGGCTGGAGGAAGAGGATGG - Intronic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1135785549 16:25345672-25345694 ATGAGTATGGTGAAAGAAGAGGG + Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137554202 16:49460516-49460538 GTGCGGCTGGAGAAAGAGGCAGG - Intergenic
1137776424 16:51058434-51058456 ATGGGGAGGGAGAGAGGGAAGGG + Intergenic
1137779904 16:51089197-51089219 ATGGGAATGGAGAGAGAAGGAGG - Intergenic
1137983171 16:53086816-53086838 ACAGGGATGGAGAAAGTGGGTGG - Intronic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138418370 16:56884329-56884351 ATTGGGAGGGATAAAGGGGAGGG - Intronic
1138695488 16:58808887-58808909 TTTGGGATGGGGCAAGAGGAAGG - Intergenic
1139095726 16:63702862-63702884 ATGTGGGAGGAGAAAGAGTAGGG + Intergenic
1139421456 16:66851759-66851781 ATGGGGAGAGAGGAAGAGGCTGG + Intronic
1139580486 16:67870750-67870772 AAGGGGATCAAGAAACAGGAAGG - Intronic
1139842715 16:69894504-69894526 ATGGGGACAGAGAAAAGGGATGG - Intronic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140150504 16:72359103-72359125 AGCAGGATGGAGAAAGAAGAGGG - Intergenic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141284243 16:82656260-82656282 GTGTGGCTGGAGAAAGAGGCTGG + Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141868317 16:86766381-86766403 AGGGGGCTGGAGATAGAGAAAGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142072350 16:88098138-88098160 AAGCGCATGGAGAAAGATGAGGG - Intronic
1142073871 16:88106248-88106270 AGCGGCATGGAGGAAGAGGAGGG - Intronic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142985890 17:3695267-3695289 ATGAGGATGGGGGAAGGGGATGG + Intronic
1143261928 17:5605926-5605948 AAGGGGATGGAGAAAGGGCTGGG + Intronic
1143267684 17:5652724-5652746 ATGGGGAGGGAGGAAGGGCAAGG + Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143941243 17:10544259-10544281 TTGGGGAGGGAGAAAGTGGTAGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144560967 17:16320137-16320159 AAGGGAAGGGAGAGAGAGGAAGG + Intronic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144785325 17:17828132-17828154 ATGGGGGTGGAGGCAGACGAGGG - Intronic
1145034287 17:19529569-19529591 TTGGAGATGGAGGAAGAGGGAGG + Intronic
1145240856 17:21240505-21240527 ATGAGCTTGGAGAATGAGGAAGG + Exonic
1145905135 17:28512104-28512126 AAGGGGATGGAGAAATGGGCTGG - Intronic
1145967452 17:28930084-28930106 ATTGAGCTGGAGAAAGAAGAGGG - Intronic
1145981936 17:29018007-29018029 ATGGGGTTTCAGAAAGAGCAGGG - Intronic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146701249 17:34962075-34962097 AAGGAGATGGAGAAAGAAAAAGG + Exonic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147511907 17:41077067-41077089 AGGGAAATAGAGAAAGAGGAAGG + Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1148082418 17:44974869-44974891 ATGGGGATGGAGTAGGGGGCAGG + Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148432189 17:47650716-47650738 AGCGGGAGGGAGAAAGAGGGAGG + Intronic
1148441293 17:47712986-47713008 ATGGAGGTGGAGAAATAGCAGGG - Intergenic
1148448718 17:47759107-47759129 GGGGAGATGGAGGAAGAGGAGGG + Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148614674 17:48991234-48991256 AGGGGCAGGGAGGAAGAGGAAGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148854399 17:50570810-50570832 AGGGGGATGGGGTAGGAGGAGGG + Intronic
1149121787 17:53177102-53177124 AAGGAGGTGGAGGAAGAGGAGGG - Intergenic
1149161694 17:53701346-53701368 ATGGAGATGGAGCAAGTGGTAGG + Intergenic
1149613016 17:57971429-57971451 ATTGGGTTGGAGAGAGAGGGAGG - Intergenic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1151177085 17:72297618-72297640 ATGAGGCTGAAGGAAGAGGAAGG + Intergenic
1151353873 17:73547033-73547055 AGGGGGATGCATACAGAGGAGGG - Intronic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152279450 17:79376672-79376694 CGGGGGCTGGAGGAAGAGGAGGG + Intronic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152343453 17:79737792-79737814 AAGGGGGCGGTGAAAGAGGAAGG + Intronic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1152835320 17:82526393-82526415 ATAGGGCTGGAGAATAAGGAAGG + Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1152948451 17:83211580-83211602 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948466 17:83211629-83211651 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1153059637 18:982008-982030 GTGGGGAGAGAGAAAGTGGAAGG - Intergenic
1153478008 18:5518052-5518074 GTGGGGATGGAGAGAGGAGACGG - Intronic
1153502434 18:5762829-5762851 ATGGGGATGGTGCAATGGGATGG + Intergenic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1153902509 18:9630543-9630565 AAGGGGATGGAAAAAGTGAAGGG - Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155066538 18:22273768-22273790 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066546 18:22273791-22273813 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155434090 18:25792982-25793004 ATGGGGAAAGAGAAAGCAGAGGG - Intergenic
1155567120 18:27147529-27147551 AGTGGGAAGGAGATAGAGGATGG - Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1156111417 18:33731830-33731852 AGGGGGAAGGAGACAGAGAAAGG - Intronic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1157104511 18:44760737-44760759 ATGGGTATGGAAATAGAGGGAGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157602454 18:48902331-48902353 AAGGGGATGGAGAAAGGGGAAGG - Intergenic
1157859228 18:51125759-51125781 ATGGGGAGCTAGAAAGAGAATGG + Intergenic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158123898 18:54081465-54081487 ATGGGGATGGAAAGGGAGGAAGG - Intergenic
1158426783 18:57347510-57347532 ATGGAGGTGGAAAGAGAGGACGG - Intergenic
1158503895 18:58028826-58028848 AAATGGATGGAGAGAGAGGAAGG + Intergenic
1158617515 18:59001765-59001787 ATAAGTATGAAGAAAGAGGAAGG - Intergenic
1158674944 18:59509899-59509921 ATGGGGATGGTCTAAGGGGAAGG + Intronic
1158770560 18:60512236-60512258 ATGGGGTTGGCTACAGAGGATGG + Intergenic
1158820773 18:61156382-61156404 GTGGGAATGGAGAAAGAAGAGGG - Intergenic
1158911558 18:62068183-62068205 ATGGGGATGAAGGAAGGAGACGG + Intronic
1159198849 18:65156831-65156853 AAGGGGAGGGAGAAAGATAAGGG - Intergenic
1159652789 18:70997402-70997424 ATGTGGATGAATAAAGAGCAGGG + Intergenic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1159862792 18:73669140-73669162 GAGGGGATGGAGAAAGGGAAAGG + Intergenic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160448601 18:78946903-78946925 AGGAGGATGGTGAAAGATGAGGG + Intergenic
1160448658 18:78947064-78947086 AGGAGGATGGAGGAAGAGGAAGG + Intergenic
1160676567 19:394319-394341 AAGGTGATGGAGAAGGATGATGG + Intergenic
1160676884 19:395707-395729 AGGGTGATGGAGAAGGACGATGG + Intergenic
1160825986 19:1080801-1080823 ACGGGGCTGGAGAGAGAGGGGGG + Intronic
1160929991 19:1566123-1566145 ATGGGGAGGCAGTAACAGGATGG + Intronic
1161595489 19:5149083-5149105 GTGGGGATGGAGACAGACGTAGG - Intronic
1161660285 19:5541590-5541612 ATGGGGTGAGAGAGAGAGGAGGG + Intergenic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162470608 19:10870618-10870640 AGGGGGATGCAGAGAGAAGACGG + Intergenic
1162565208 19:11442150-11442172 ATGGGGCTGGAGAATCAGGCAGG + Intronic
1163162719 19:15475164-15475186 AGGGTGAGGGAGAGAGAGGAGGG + Intronic
1163184519 19:15628604-15628626 CGGGGGATGGAGAAACAGGGAGG - Intronic
1163207355 19:15813449-15813471 ATGGGGATAGAGAGAGAGGCAGG + Intergenic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163860255 19:19739054-19739076 CTGGGGATGCAGACAGAGTAGGG - Intergenic
1164498013 19:28786382-28786404 ATAGGTATAGAGAAAGAGAAAGG + Intergenic
1164559104 19:29276395-29276417 GGGGTGATGGAGGAAGAGGATGG - Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164721832 19:30438238-30438260 GTGGGGAGGGAGAGAGGGGAGGG - Intronic
1164823766 19:31269062-31269084 GTGTGGCTGGAGATAGAGGAAGG - Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1165100544 19:33436145-33436167 AGGAAGATGGAGGAAGAGGAAGG + Intronic
1165347796 19:35259712-35259734 TTGGGGATGTAGCAAGAGGTGGG - Intronic
1165355049 19:35299461-35299483 ATGGAGGTGGACAAGGAGGAGGG + Intronic
1165416031 19:35694085-35694107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165454315 19:35901898-35901920 AGGGAAATGGAGAAAGAGGGAGG - Intronic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1165847420 19:38827120-38827142 GAGGGGAGGGAGAAAGGGGAGGG + Intronic
1165947334 19:39452061-39452083 ATGGGGCTGGGGGAAAAGGATGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166147771 19:40849211-40849233 AGAGTGATGGAGGAAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151907 19:40880982-40881004 AGAGAGATGGAGGAAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166194033 19:41194515-41194537 GTAGGGAGGAAGAAAGAGGAGGG - Intronic
1166297672 19:41896940-41896962 AGGGGGAAGGTGAGAGAGGAGGG - Intronic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
1166408271 19:42539406-42539428 GTGGTGCTGGAGAAAGGGGAAGG - Intronic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1166476891 19:43134409-43134431 ATGGGGATGGAGAACTGGAATGG - Intronic
1166921321 19:46230874-46230896 GTGGGCCTGGAGAAAGAGGCTGG + Exonic
1166975817 19:46604443-46604465 TTAGGGAGGGGGAAAGAGGAAGG - Intronic
1167442628 19:49517518-49517540 AGAGGGAGAGAGAAAGAGGAAGG + Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167521758 19:49959647-49959669 GTGGGGGTGGAGAGAGAGAATGG + Intronic
1167523625 19:49971075-49971097 GTGGGGGTGGAGAGAGAGAATGG - Intergenic
1167554794 19:50187916-50187938 ATGGGAATGAAGGGAGAGGAAGG + Intergenic
1167607449 19:50489010-50489032 AGGGGGAGAGAGAAAGAGGGAGG + Exonic
1167608204 19:50492919-50492941 AGGAGGAGGGAGTAAGAGGAAGG + Intergenic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167643376 19:50693892-50693914 ATGGGGACAGAGACACAGGATGG + Intronic
1167663191 19:50808458-50808480 ATGGGGCTGGATAATGGGGATGG - Intergenic
1167672371 19:50860623-50860645 ATGGGGATGAAGTAAGGAGAGGG + Exonic
1167689828 19:50978487-50978509 ATGGGGGTGGAAAAGAAGGAGGG + Intronic
1167689844 19:50978574-50978596 ATGGGGGTGGAGAAGAAAGAGGG + Intronic
1168069232 19:53940620-53940642 ATGAGGTTAGAGAAAGGGGAAGG - Intronic
1168185135 19:54695680-54695702 AGAGGGAGGGAGGAAGAGGACGG + Intronic
1168246471 19:55115139-55115161 AGAAGGATGGAGAAAGAGAAAGG + Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925171109 2:1750748-1750770 ATGGGGATGGGGAGAAGGGAGGG - Intergenic
925619446 2:5776895-5776917 AAGGGGCTGGGGAAAGAAGAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925650558 2:6085268-6085290 ATGGGGCGGGAGACAGAGAAGGG + Intergenic
925755313 2:7127941-7127963 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755418 2:7128135-7128157 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755441 2:7128176-7128198 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755464 2:7128217-7128239 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755471 2:7128230-7128252 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925755494 2:7128271-7128293 AAGGGGAGGGGGAAAGGGGAGGG - Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
926284043 2:11473230-11473252 GGGAGGATGCAGAAAGAGGAGGG + Intergenic
926382021 2:12300537-12300559 AGAGGTATGGAGAGAGAGGAAGG - Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926614737 2:14984679-14984701 CTGGGGGTGGAGAAAGGGGTGGG - Intergenic
926797591 2:16631526-16631548 ATGGGGCTGTAGAAAGAGCCTGG + Intronic
926862229 2:17321509-17321531 CTGGGGATGGGAAAAGGGGATGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927291014 2:21405088-21405110 TTGGGAATGGAGAATGAAGAGGG + Intergenic
927314419 2:21665407-21665429 ATGGGGACGGAGAAAGCCCAAGG - Intergenic
927581871 2:24257941-24257963 AGGTGCATGGAGGAAGAGGATGG - Exonic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927842255 2:26453252-26453274 ATGAGCATGGAGAGAGAGGCAGG - Intronic
928106742 2:28475421-28475443 ATGGTGGTGGAGAAGGAGGAAGG - Intronic
928174368 2:29024038-29024060 GTGGGGGTGGAGGAAGAGGGTGG + Intronic
928239372 2:29573114-29573136 AAGGGGAGGGAGAGAAAGGAGGG - Intronic
928314302 2:30233785-30233807 CTGGGGCTAGAGAAAGGGGATGG + Intronic
928341168 2:30444157-30444179 ATGGGGGTGGGGAACGGGGAAGG + Intergenic
928494026 2:31813456-31813478 ATGGGGAGCTAGAAAGTGGATGG + Intergenic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
928697662 2:33865922-33865944 AAGAGGATGGTGAAATAGGATGG + Intergenic
928840657 2:35600426-35600448 AGGGGGCTGGCTAAAGAGGATGG + Intergenic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929208981 2:39332375-39332397 ATGGGTATGGAGAAAGTGAATGG - Intronic
929231955 2:39569207-39569229 TTGAGGAGGGAGAAAAAGGAAGG - Intergenic
929247114 2:39714228-39714250 AGGGGGATGGAGAGAGGGGATGG + Intronic
929362633 2:41112716-41112738 ATGGGGGGGATGAAAGAGGAAGG - Intergenic
929832106 2:45355478-45355500 GTGTGGTTGGAGAAAGTGGAGGG - Intergenic
929852418 2:45604384-45604406 AGGGGGGTGGAGGAAGGGGAGGG + Intronic
929915355 2:46131207-46131229 CTGGGGATGGAGTCAGAGGCAGG + Intronic
929931088 2:46256022-46256044 ATGAGGATGGAGCAAGGAGAGGG - Intergenic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930245891 2:48982993-48983015 ATGGGGTTGAGGAAAGAAGAAGG + Intronic
930672681 2:54167992-54168014 ATTGGGATGGAGAAATGGGATGG - Intronic
930752259 2:54945211-54945233 AGGGGGAGGGAGAGAGAGAAGGG - Intronic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
930952767 2:57163292-57163314 ATGAGGATGGAGAGAGAAGCTGG + Intergenic
931123636 2:59249461-59249483 ATGGGGATTGAGAAAATTGAAGG - Intergenic
931241009 2:60452672-60452694 AAGAGGTTGGAGACAGAGGAGGG + Intronic
931340771 2:61398579-61398601 CGGGGGAGGGAGAAAGGGGAGGG + Intronic
931340774 2:61398592-61398614 AAGGGGAGGGAGAAAAGGGAAGG + Intronic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932509926 2:72276044-72276066 AGAGAGATGGAGATAGAGGAGGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932774469 2:74519298-74519320 AAGGGGATTGAGAAAGAGTAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933143111 2:78817915-78817937 ATGAGGAAGGATAAAGAGCATGG + Intergenic
933222759 2:79709739-79709761 GTGGTAATGGAGAAATAGGATGG + Intronic
933503824 2:83151872-83151894 ATAGAGTTGGAGGAAGAGGAAGG + Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935135351 2:100295671-100295693 AAAGGGATGGAGAGAGAGGCGGG + Intronic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935686596 2:105689130-105689152 ATGGGGTTGGAGGAGGTGGAAGG - Intergenic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936459958 2:112706332-112706354 AAGGGGGTGGAGAGAGGGGAAGG - Intergenic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
936627756 2:114166570-114166592 AGGGGGTTGGAGAAAGGGGATGG + Intergenic
936752187 2:115658334-115658356 ATTGGGGTGGAGAAAGAACAAGG - Intronic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937110586 2:119364077-119364099 AGGGGGAGGGAGAGAGAGGTAGG + Intronic
937217299 2:120321072-120321094 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217303 2:120321085-120321107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217307 2:120321098-120321120 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217316 2:120321127-120321149 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937412752 2:121690593-121690615 ATGGGGGAGGAGTAAGGGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937544804 2:123004158-123004180 ATGGGGCTGGGAATAGAGGATGG - Intergenic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
938451139 2:131422002-131422024 ATGGGGAGGGAGAAAAATCACGG - Intergenic
938776379 2:134544965-134544987 AGGGGGCTGGGGACAGAGGAAGG - Intronic
938926482 2:136047850-136047872 AAGCAGATGGAGAAAGAGGTGGG + Intergenic
939010102 2:136836561-136836583 ATGGGGATCTAGAAAGGTGATGG - Intronic
939044657 2:137236164-137236186 ATGGGGATAGAGAAATGGAAAGG + Intronic
939123919 2:138152304-138152326 AGGGGGAAGAAGAAAGAAGAAGG - Intergenic
939124081 2:138154475-138154497 ATGGGTTTGTAGAAAGAGGTGGG - Intergenic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
939502234 2:143002054-143002076 ATGGGGATGGGGAAAGACAATGG + Intronic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940383482 2:153043572-153043594 GTTGGCATGGAGAGAGAGGATGG + Intergenic
940465875 2:154025952-154025974 ATGGGGAGGGAGAGAGAGAAGGG + Intronic
940636372 2:156302427-156302449 ATGGGTATGGAGACAGAAGCAGG - Intergenic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
940664587 2:156592846-156592868 ATGGGGGTGGGGGAAGACGAAGG - Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941440045 2:165523371-165523393 ATGGTGGTGAAGAAAGAGGTTGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941558619 2:167016178-167016200 AGGAGGAAGGAGAAAAAGGAGGG - Intronic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
941835020 2:170006631-170006653 AGGGGTATGGGGTAAGAGGAGGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942168377 2:173264861-173264883 GGGGAAATGGAGAAAGAGGAAGG + Intronic
942173341 2:173308379-173308401 ATGGGGATCTGGAAAGAGAATGG - Intergenic
942177879 2:173352366-173352388 ATGAGGATAGAGAGACAGGATGG + Intergenic
942215225 2:173712873-173712895 ATGAGGGTGGAGAGAGAGGCAGG - Intergenic
942725237 2:178999352-178999374 ATGGGGATGGAAATAGAGAAAGG - Intronic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943662146 2:190570591-190570613 AGGAGGATGGAGCAACAGGATGG + Intergenic
943703958 2:191015361-191015383 ATGGGGTTGGACAAAGAGATCGG - Intronic
944343259 2:198629666-198629688 ATAGAAATGGAGAAAGTGGACGG - Intergenic
944412100 2:199456120-199456142 AGGGGGAGGGAGAAAAAAGAGGG + Intronic
944913348 2:204331995-204332017 ATGGAGATGGAGAAAGGGCAAGG - Intergenic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945015213 2:205508081-205508103 GTAGGGATAGTGAAAGAGGAGGG + Intronic
945427914 2:209730109-209730131 TGGGAGATGGAGAAAGAGGTAGG + Intronic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946237387 2:218332535-218332557 ATGGGGAAGGAGGAAGGGAAGGG - Intronic
946285226 2:218697647-218697669 ACGGGGAGGGAGAAAGAAGAAGG + Intronic
946299810 2:218815785-218815807 ATGGGTATTGAGAGACAGGATGG - Intergenic
946300931 2:218823669-218823691 ATGGGGGTGGGGGAAGATGAAGG + Exonic
946494922 2:220186497-220186519 ATGGAGATGGAGAAAATGAATGG + Intergenic
946643268 2:221806911-221806933 TTTGGGAAGGAGAGAGAGGAAGG - Intergenic
946678728 2:222190567-222190589 AGAGGGTTGGACAAAGAGGAGGG - Intergenic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
946868396 2:224063347-224063369 AGGGAGACGGAGAAAGAGAAGGG + Intergenic
947267876 2:228302763-228302785 TTAGGGAGGGAGAGAGAGGAGGG + Intergenic
947349464 2:229227670-229227692 TTAGGGATGAAGAAAGAGCAAGG - Intronic
947363755 2:229372787-229372809 ATGGGCATGGAGACAGAGAGAGG + Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947510998 2:230754348-230754370 AAGGGGACGGAAGAAGAGGAAGG - Intronic
947681752 2:232040160-232040182 ATGGGAATAGAGAAAGAGAGAGG + Intronic
947924639 2:233910708-233910730 TTAGGGATGGAGAGAGAGAATGG - Intergenic
948091959 2:235302248-235302270 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
948310805 2:236984950-236984972 ATGGGGATGGAGTAAAAAGATGG + Intergenic
948805949 2:240453486-240453508 ATGGGCCTGGCGGAAGAGGAAGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1169020356 20:2326422-2326444 ATGGGGCAGGAGACAGAGGGAGG - Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169525958 20:6426107-6426129 ATGGCGGTGGAGAAAAAAGAGGG - Intergenic
1169525998 20:6426323-6426345 AAGGGGAGGGAGAGAGAGGGAGG - Intergenic
1169663571 20:8007600-8007622 ATGGGGATGGAGAAGTAGCTAGG - Intronic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1169939784 20:10924606-10924628 AGGGGGGTGGAGAAAGAGCAGGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170206349 20:13802778-13802800 AGAGTGATGGGGAAAGAGGAAGG - Intronic
1170477417 20:16729837-16729859 ATGGAAATGGGGAAAGAGAAGGG - Intergenic
1170781598 20:19430433-19430455 ATAGGGAGGGAGGAAAAGGAGGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171151909 20:22834893-22834915 AAAGGAATGGAGGAAGAGGAGGG - Intergenic
1171284491 20:23925944-23925966 GTGGGGAGGGAGAAGGAGGGAGG - Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172073074 20:32272859-32272881 GTGAGGATGCAAAAAGAGGAAGG - Intergenic
1172080801 20:32339080-32339102 ATGGGGATGGAGAACGGGGCTGG + Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172554886 20:35832236-35832258 AAGGGGATCGAGTGAGAGGAGGG - Intronic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173527062 20:43741128-43741150 ATGGGGAAGGAGGAAAAGAAAGG - Intergenic
1173726717 20:45303580-45303602 ATGGGGATGGGGTCAGAGGCAGG + Intronic
1173952809 20:47006581-47006603 AGAGGTATGGAGGAAGAGGAGGG - Intronic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174631186 20:51959032-51959054 ATTGGAATGGAAAAAAAGGAGGG - Intergenic
1174832715 20:53827767-53827789 ATGGGGAGGAAGAAAGAAGGAGG - Intergenic
1175021574 20:55856565-55856587 ATGGGGCTGGAGACAGAGATTGG + Intergenic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175444424 20:59010267-59010289 CTGGGACTGGAAAAAGAGGAGGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175503316 20:59465476-59465498 AGGAGGAGGGAGACAGAGGAAGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176027350 20:62992868-62992890 AGAGGGATGGAGGAAGAGGAGGG + Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177220939 21:18192007-18192029 CTTGGGTTTGAGAAAGAGGAAGG + Intronic
1177385309 21:20402365-20402387 ATGGGGATGGTGAAAGTAGGTGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178375534 21:32064582-32064604 AGGGGGAGGGAGAAAGAGAGAGG + Intergenic
1178431572 21:32522520-32522542 AAAGGGAGAGAGAAAGAGGAGGG - Intergenic
1178638618 21:34327656-34327678 ATGGAGATGTACAAAGGGGAGGG - Intergenic
1178998662 21:37432204-37432226 AAAGGGAGGGAGGAAGAGGATGG + Intronic
1179069409 21:38057688-38057710 ATAGGGATAGAGAGAGAGAAGGG - Intronic
1179101359 21:38357865-38357887 GTGAGGCTGGAGAGAGAGGAAGG - Intergenic
1179952672 21:44718896-44718918 ATTGGGATGGGGACAGAGGAAGG - Intergenic
1180155825 21:45977097-45977119 ATGAGGATGGAGCATGAGGTGGG - Intergenic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181629371 22:24142548-24142570 AGAGGGATGGAGAGAGAGAAGGG - Intronic
1181880974 22:25979798-25979820 ATTGGGATGGAGAAGGGGAAGGG - Intronic
1181886029 22:26023107-26023129 GTGGTGATGGAGAAGAAGGAAGG - Intronic
1182282831 22:29226978-29227000 GGGGGGATAGAGAAAGGGGATGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182456589 22:30455658-30455680 TTGGGGAAGGAGTAAGAGGCAGG + Intronic
1182768197 22:32774066-32774088 ATGGGCTTGGAGGGAGAGGAAGG + Intronic
1182788890 22:32932278-32932300 AGATGGATGGAGCAAGAGGAGGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1182951594 22:34381306-34381328 ATGGGGATGAAGAAAGAGGTAGG + Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183381273 22:37491657-37491679 AGGGGGAGGGAGAGAGAGGGGGG + Intronic
1183464357 22:37972155-37972177 AAGGGGGTGGGGAAAGAGGGAGG + Intronic
1183520382 22:38293343-38293365 AGGGGGAGGGAGAGAGAGGGAGG + Intronic
1183590349 22:38776197-38776219 ATGGGGGTGGGGAGAGAGGACGG - Intronic
1183627824 22:39015414-39015436 ACGGGGAGAGAGAAAGAGGAGGG - Intronic
1183630409 22:39029195-39029217 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183633870 22:39049281-39049303 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183660832 22:39220312-39220334 AAAGGGAGGAAGAAAGAGGATGG + Intergenic
1183731761 22:39622358-39622380 ATGGGGATTGAGTAGGTGGAGGG + Intronic
1183954542 22:41371492-41371514 CTGGAGATGGAGAGAGAGGGGGG - Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184485842 22:44778846-44778868 GTGGGGTTAGAGAGAGAGGAGGG - Intronic
1184487578 22:44790148-44790170 CTGGGGTTGGAGAATGATGACGG + Intronic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185128072 22:49022741-49022763 CTTGGTGTGGAGAAAGAGGAGGG + Intergenic
1185170646 22:49291765-49291787 GTGGGGATGGAGACAGAGACTGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949647181 3:6109381-6109403 AGAGGGAGGGAGAAAGAGGAAGG - Intergenic
949713885 3:6905564-6905586 AGAGGGAGAGAGAAAGAGGAAGG - Intronic
949722555 3:7007538-7007560 CTGGGAATGGAGAAAGAAAAGGG - Intronic
949785004 3:7731299-7731321 AAAGGGATGGAAAAAAAGGATGG + Intronic
949869089 3:8571559-8571581 TTGGGGATGGAGACAAAGGGAGG + Intergenic
949930407 3:9073936-9073958 ACGGGGATGGAGAAAGAGTCAGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950195373 3:11005719-11005741 AGAGGGATGGAGAGAGAGGAGGG - Intronic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951651380 3:24955186-24955208 AAGGGGATGGTGTAAGAAGAAGG + Intergenic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952582601 3:34852358-34852380 ATGGGCCTGGAAAAAGAGCAAGG - Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952855751 3:37769532-37769554 ATGGGCCTGGACACAGAGGAGGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953188438 3:40660665-40660687 GTGAGGAGGGAGAAAGAAGAAGG + Intergenic
953345477 3:42171964-42171986 ATGGGGACGGAGAGGGGGGATGG - Intronic
953685316 3:45073582-45073604 ATGGTGAAGGAGAAAGAGATAGG + Intergenic
953763860 3:45717662-45717684 ATGTGGAAGGAGAAAAAGTAAGG + Intronic
954093904 3:48307461-48307483 ATGAAAATGGAGAAAGAAGAGGG - Intronic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954613808 3:51959513-51959535 AGGGGGATTGAGATAGAGGAGGG - Intronic
955075777 3:55611689-55611711 CTGGTGATGGAGAGAAAGGAGGG - Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955113290 3:55971615-55971637 AGGGGGCTGGAGAGAGAGAATGG + Intronic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
956001482 3:64734262-64734284 ATGGGGACGGAGCAAGAAGGTGG - Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956290084 3:67651999-67652021 TTGGGGATGGTGAATGAGGCAGG - Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956472498 3:69582149-69582171 ATGAGGTGGGAGAAAGGGGAGGG + Intergenic
956551653 3:70467550-70467572 GTAGGGATGGGGAAAGAGGGTGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956796282 3:72721759-72721781 ATGGGGCTGGGGACCGAGGAAGG - Intergenic
957065697 3:75520102-75520124 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
957462875 3:80545119-80545141 ATAGGGAAGTAGAAAGAGAAGGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958706513 3:97663138-97663160 ATGGGGTAGGACAAAGGGGAAGG + Intronic
959427765 3:106214085-106214107 ATGAGGATGGACAAATATGAAGG - Intergenic
959583239 3:108003117-108003139 CTGGGGATGGAGACGCAGGAGGG - Intergenic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960225842 3:115167502-115167524 ATGGGGATGGAGGAAGAATTTGG + Intergenic
960358175 3:116678758-116678780 ATGGGGATGGAGCAGGAAGGTGG - Intronic
960529033 3:118742650-118742672 AAGGAGCTGGAGAAAGAGAATGG + Intergenic
960577320 3:119241933-119241955 ATGGGGAGGGAGACAGAGAGGGG - Intergenic
960581246 3:119280956-119280978 ATAAGAATGGAGAAAGAGAAGGG - Intergenic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
960787012 3:121384605-121384627 ATGAGGATGGAAAAATAGGCAGG + Intronic
960787021 3:121384822-121384844 ATGGGGACGGGGACAGAGAAGGG - Intronic
961002827 3:123385372-123385394 GAGGGGATGGAGAAAGGAGAGGG + Intronic
961025523 3:123552310-123552332 ATAGGGAAAGAGAAAGAGGCAGG + Intronic
961088786 3:124092232-124092254 TTGGGGCTGGAGAAAGAAGCTGG - Intronic
961287455 3:125817960-125817982 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
961787504 3:129356617-129356639 ATGGGGCTGGGTAAATAGGAAGG + Intergenic
961899622 3:130198020-130198042 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
962058779 3:131903332-131903354 ATGTGAATGGAGAAATAGGGAGG - Intronic
962278034 3:134030268-134030290 GAGGGGATGGAGAAAGAGGTTGG + Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962936163 3:140082660-140082682 AAGGGGATGGTGACAGAGCAAGG - Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963796292 3:149634069-149634091 ACAGGAATGGAGAAAGAGGAAGG + Intronic
964349188 3:155786112-155786134 ATGGGAAAGGAGAAAGGGAAGGG + Intronic
964716526 3:159728361-159728383 AGGAGGATGGAGAATGAGGCAGG + Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
965350096 3:167600570-167600592 ATAGGGATGGAGCAAGATCATGG - Intronic
966099644 3:176251140-176251162 GAGGGGAGGGAGAAAGAGGGAGG + Intergenic
966300877 3:178478653-178478675 ATGGGGCTGGAGAAATAGATGGG + Intronic
966535596 3:181030110-181030132 ATGGGGATAGAGAAAGAATGGGG - Intergenic
967095516 3:186174392-186174414 AAGGTTATGGAGGAAGAGGAAGG + Intronic
967157307 3:186705382-186705404 TTGGGGATGGGGATAGGGGAAGG - Intergenic
967298717 3:187991065-187991087 GTGGCGATGGAGAAGGAGAAAGG - Intergenic
967440263 3:189499649-189499671 TGGGGGATGGAGAAAATGGAGGG + Intergenic
967456477 3:189692433-189692455 GTGGGGAGGGAGGAAGGGGAAGG - Intronic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967691591 3:192480117-192480139 GTGGGGATGGAGACAAAGAAAGG + Intronic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
968035559 3:195544681-195544703 ATGTGGATGGAGATAATGGAGGG + Intergenic
968087011 3:195878342-195878364 CTGGGCCTGGAGGAAGAGGAAGG + Exonic
968096473 3:195934131-195934153 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968530026 4:1086718-1086740 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530059 4:1086813-1086835 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530066 4:1086832-1086854 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530095 4:1086908-1086930 ATGGGGTGGGGGCAAGAGGATGG + Intronic
968530109 4:1086946-1086968 ATGGGGTCGGGGAGAGAGGATGG + Intronic
968530129 4:1087003-1087025 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968713560 4:2138244-2138266 ATGGGGTTGGAGAAGCAGGTGGG + Intronic
968823842 4:2878093-2878115 GTGAGGTTGGAGAGAGAGGAGGG + Intronic
968881336 4:3301661-3301683 CTGGGGATGGAGAGTGAGGCCGG + Intronic
968951616 4:3697823-3697845 GTGGGGATGGAGAAAGGGCTGGG + Intergenic
969010286 4:4056175-4056197 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969581899 4:8070766-8070788 CTGGGGAAGGAAAGAGAGGAGGG + Intronic
969743763 4:9053719-9053741 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
969803169 4:9585818-9585840 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
969963351 4:10969571-10969593 AAAAGGATGGAGAAAGAAGAGGG - Intergenic
969969080 4:11027543-11027565 TTGGGGATGGGGCAAGAGAAGGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970926628 4:21459837-21459859 ATGGTGATGGTGAAAGTGGTTGG - Intronic
971119855 4:23691116-23691138 GAGGGGATTGGGAAAGAGGAGGG + Intergenic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569048 4:40294359-40294381 ATGGAGATGGAAATAGAGGTGGG - Intergenic
972789506 4:42357421-42357443 ATGGGGAGAGAGAGAGAAGAAGG + Intergenic
973001749 4:44960910-44960932 AGGGAGATGGGGAAAGGGGAAGG - Intergenic
973178620 4:47240869-47240891 AAGGTGAAGGAGAAAGAGAATGG - Intronic
973602478 4:52555848-52555870 ATGGGGTTGGAGGAGGAGAAGGG - Intergenic
973872048 4:55176387-55176409 ATCAGGAGGGAGAAAGAGCAGGG + Intergenic
974145541 4:57943120-57943142 ATGGGGATGAAGGAGGAGAAGGG + Intergenic
974173647 4:58296848-58296870 AAGGTGATGGACATAGAGGAAGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975231484 4:71939399-71939421 GGGGAGATAGAGAAAGAGGAAGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975390656 4:73813400-73813422 ATGAGGATGGAGAGACAGGATGG + Intergenic
975462901 4:74675260-74675282 GTGGGGCTAGAGAAAGAGGATGG + Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976416975 4:84787834-84787856 TTTGGGGTGGAGAAACAGGAAGG + Intronic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976886118 4:89986598-89986620 ATGAGTTTGGAGAAAGAGGAAGG - Intergenic
977116097 4:93030795-93030817 AGAGGAATGGAGACAGAGGAAGG + Intronic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977320706 4:95512070-95512092 ATGGGTCTGGAGAAGGAGGCAGG + Intronic
977320934 4:95515005-95515027 ATGGAGATGGAGAAATATCAAGG - Intronic
977370363 4:96126669-96126691 ATGGGAAAGGAGAAAGAAAAGGG + Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977579613 4:98710741-98710763 ATGGGGCTAGGGATAGAGGATGG + Intergenic
977919239 4:102625343-102625365 ATGGTGAGAGAGAAAGAGAAAGG - Intergenic
978107165 4:104916996-104917018 ATGTGGCTGGAGAAAGATGGAGG + Intergenic
978214059 4:106176303-106176325 ATGGGGATGAAGAGAGAGGTTGG - Intronic
979552338 4:122005090-122005112 ATGAGGATCGAGATGGAGGAGGG - Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979814702 4:125086431-125086453 AAGGAGGTGGAGAGAGAGGAGGG - Intergenic
979817102 4:125122641-125122663 TTGGGGATGCAGGAAGATGAAGG + Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
979972907 4:127159677-127159699 AAGGGGAAGGAAAGAGAGGAAGG + Intergenic
980198239 4:129619616-129619638 ATGATGATGGATAAAAAGGATGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981013581 4:139951127-139951149 ATGGGGAGAAAGAAAGAGGGAGG - Intronic
981087398 4:140698303-140698325 ATGGGGATTGAGTGAGAGGAAGG - Intronic
981563901 4:146077803-146077825 ATGGTGGTGGAGACAGAGGGTGG - Intergenic
981576526 4:146211759-146211781 ATGGGGTTTGAGACAAAGGAAGG - Intergenic
981689750 4:147494595-147494617 ATGAGGGTGGAGCAAGAGTAGGG + Intronic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982432917 4:155343268-155343290 AGTGGGAGAGAGAAAGAGGAGGG + Exonic
982700519 4:158656199-158656221 ATTGGGATGAAGAGAGTGGAAGG - Intergenic
982995972 4:162346109-162346131 ATGTTGATGGAGAATAAGGAAGG + Intergenic
983049073 4:163022830-163022852 ATGGGAATGGTGAAAGAGAAGGG + Intergenic
984107321 4:175564459-175564481 ATGAAGATGGAGACAGAGGTTGG + Intergenic
984153125 4:176159423-176159445 ATGTGAAGGGAGAAAGGGGATGG - Intronic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984776436 4:183485261-183485283 GTGGGCATAGAGAAAGAGCAAGG + Intergenic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985655345 5:1128926-1128948 ATGGGGATGGAGCACGTGGCAGG - Intergenic
985704594 5:1393047-1393069 CTGGGGAGGGACACAGAGGACGG - Exonic
985779247 5:1861339-1861361 TTGGGGATGGAGGGAGATGAAGG + Intergenic
985783130 5:1881231-1881253 AAAGGGGTGGAGAAAGGGGAGGG + Intronic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986658445 5:10038120-10038142 ATGGGAAGGGAGTGAGAGGAAGG - Intergenic
986694206 5:10337841-10337863 ATGGGCAGAGAGAAAGAGAAGGG + Intergenic
986773514 5:10994371-10994393 AAGGGGCCGGGGAAAGAGGAGGG + Intronic
986826954 5:11532282-11532304 GTGGGTTTGGAGAAAAAGGAGGG - Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987205387 5:15619963-15619985 ATGGGGATAGAGAAAACAGAGGG + Intronic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987423186 5:17744884-17744906 CTGGGGATGGAAAAAAGGGACGG + Intergenic
987846845 5:23297588-23297610 ATGGGGATAAAGAAAGCAGAGGG + Intergenic
988022333 5:25637072-25637094 ATTGGGAGGGAGTAAGTGGAGGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988364471 5:30278122-30278144 GTGGGGATGGGGGTAGAGGAGGG + Intergenic
988497675 5:31758698-31758720 ATGAGGATGGAGGAAAGGGAGGG - Intronic
988713753 5:33804211-33804233 ATGAAGATGGGGGAAGAGGAAGG - Intronic
988801151 5:34698055-34698077 AAAGGGAGGGAGAAAGGGGAGGG - Intronic
988924095 5:35971703-35971725 CTGGGGTTGGAGCAAGAGGGAGG - Intronic
989134943 5:38144454-38144476 AAGGAAATAGAGAAAGAGGAAGG - Intergenic
989406779 5:41070170-41070192 AAGGGTATGGAAAAAGAAGATGG - Intronic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
989785372 5:45321210-45321232 TTAGGGATGTAGAAAGAGGATGG + Intronic
989973639 5:50555403-50555425 ATGGGGATAGAGAAGGAAGTGGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990352599 5:54933819-54933841 ATGAGGAGGGAGAAGGAGAAGGG - Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
990610958 5:57456484-57456506 GTGGGGATGGAGAAAGAAGGAGG + Intergenic
990742923 5:58930626-58930648 ATGGGAGTAGAGAAAGAGGACGG - Intergenic
990771737 5:59254266-59254288 CTTGGGATTGAGAAATAGGAGGG - Intronic
990948722 5:61275860-61275882 ATGGGGCTGGAGAAGGAGGTAGG - Intergenic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992487325 5:77209995-77210017 GTGGGGCTGGGGGAAGAGGACGG + Intergenic
992701348 5:79344469-79344491 AGGGGACTGGAGAAAGAGAAGGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
992971391 5:82062622-82062644 ATGTGAATGGAGAAACATGAAGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993159187 5:84266697-84266719 ATAGGAATGTAGAGAGAGGAAGG - Intronic
993401007 5:87450957-87450979 ATGGGGATGGGGCATAAGGATGG + Intergenic
993813774 5:92515318-92515340 ATAGGGCTGGAGAGAGATGAGGG + Intergenic
993866211 5:93199646-93199668 ATGGGGATGGGGAAAGAAGTGGG + Intergenic
994441281 5:99807601-99807623 ATGGTGATTGAGATAGGGGAGGG - Intergenic
994648411 5:102498234-102498256 ATTGCCATGGAGAAAGAGTAAGG - Intronic
994691853 5:103029296-103029318 ATTATGATGGAAAAAGAGGACGG - Intronic
994737630 5:103575150-103575172 ACTGGGAGGGAGAGAGAGGAAGG - Intergenic
994868311 5:105308706-105308728 AGGGGGATAGGGAAAGATGATGG + Intergenic
995402337 5:111757268-111757290 AAAGGGGTGGAGGAAGAGGAGGG + Intronic
995487194 5:112651248-112651270 AGGGGAAGAGAGAAAGAGGACGG - Intergenic
995523093 5:113029402-113029424 AAGGGGATGGAGACAGACGGGGG - Intronic
995567895 5:113450957-113450979 ATGGGGGTGAAAAAAAAGGAGGG - Intronic
996016240 5:118537281-118537303 ATGGGGGTGAATCAAGAGGATGG - Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996292295 5:121866430-121866452 ATGCTGTTGGAGAAAGAGCAGGG - Intergenic
996373593 5:122778907-122778929 AAAGGGATGGAGACAGAGAAGGG + Intronic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
996671872 5:126127505-126127527 ATGGGGAAGGAGTCGGAGGAGGG - Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997038883 5:130227793-130227815 ATGGGAATTGGGAAAGAGGAAGG - Intergenic
997374159 5:133384946-133384968 AATGGGTTAGAGAAAGAGGAGGG - Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997457372 5:134027268-134027290 ATGGGGCGGGAGAGGGAGGAGGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997735361 5:136209035-136209057 ACTAGGAGGGAGAAAGAGGAAGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997860532 5:137411399-137411421 ATGAGGATGGAGGGAGAGGCAGG + Intronic
998040384 5:138947600-138947622 TTGGGGATAGAGGAAGAGGTGGG - Intronic
998162367 5:139820837-139820859 ATGAGGTTGGAGGCAGAGGAGGG + Intronic
998173924 5:139888839-139888861 ATGAGTATGGAGACAAAGGAAGG - Intronic
998365833 5:141630173-141630195 ATGGGGAGGGAGATATGGGAAGG - Intronic
998545528 5:143024128-143024150 AGGGGGCTGGAGAGAGAAGAAGG + Intronic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
999087239 5:148903782-148903804 ATGAGGCTGGAGAGAGAGGCAGG - Intergenic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999212833 5:149905216-149905238 GAGTGGGTGGAGAAAGAGGAGGG - Intronic
999365703 5:151022087-151022109 ACAGGGATGGATAAAAAGGAGGG - Intronic
999374549 5:151077736-151077758 CTGGGGATGGAGGTAGAGGGTGG - Intronic
999394028 5:151215130-151215152 ATGGGGGTGGGGAAAGAGACAGG + Intronic
999977026 5:156922000-156922022 TTGGGGAGGGATAAAGGGGAAGG + Intronic
1000113849 5:158135152-158135174 ATGGGGCAGGAGAAAGGAGATGG + Intergenic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000190745 5:158908443-158908465 ATGGGAAAGGAAAAAGATGAGGG - Intronic
1000230323 5:159309981-159310003 ATGGGGAGGGAAAAAGAAGTGGG + Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000734781 5:164885695-164885717 TAGAGGGTGGAGAAAGAGGAGGG + Intergenic
1000924448 5:167176867-167176889 ATCTGGATGGAGAACGTGGATGG + Intergenic
1001034063 5:168284354-168284376 ATGGGGAGGTAGAGAGTGGAGGG + Intergenic
1001256661 5:170188639-170188661 ATGAGGATAGAGAAGAAGGAGGG + Intergenic
1001308429 5:170593379-170593401 CTGGGGATGGAGAAAGCCAATGG - Intronic
1001757617 5:174182657-174182679 ATGGCTAGGGAGAAATAGGACGG - Intronic
1001791028 5:174458408-174458430 AAGGAGATGGGGAAAGAGGTGGG - Intergenic
1001791040 5:174458444-174458466 AAGGAGATGGGGAAAGAGGTGGG - Intergenic
1002020024 5:176358006-176358028 ATGATGATGAAGAAAGATGATGG - Intronic
1002152216 5:177243566-177243588 AAATGGATGGAGAAAGAGAAGGG - Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002555086 5:180030963-180030985 AGGGGGTAGGAGGAAGAGGACGG - Intronic
1002661673 5:180795166-180795188 CTGGGGATGGAGGCAGAGAAGGG + Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002742618 5:181444735-181444757 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742633 5:181444784-181444806 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002864271 6:1107452-1107474 ATGGGGATGGATGACAAGGAAGG + Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003904459 6:10686399-10686421 AAGGGAATGGGGAAGGAGGAGGG + Intronic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004036233 6:11926721-11926743 AGAGGGAGAGAGAAAGAGGAAGG + Intergenic
1004151694 6:13126297-13126319 AGGGGCAGGGAGAAAGAGAAGGG + Intronic
1004156965 6:13178220-13178242 ATGGGGCTGGAGAGAGCAGAAGG - Intronic
1004551986 6:16656675-16656697 ATGGGCAAGGTGAAAGATGATGG - Intronic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005622012 6:27628876-27628898 TGGGGGAAGGAGAAAGAAGAGGG + Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005914216 6:30338441-30338463 GAGGAGATGGAGAAAGATGAGGG + Intronic
1006113290 6:31761725-31761747 GTGGGGAGGGAGAAAAGGGAAGG - Intronic
1006137193 6:31902230-31902252 AGGGGGAGCGAGAAAGAGGGGGG - Intronic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007393289 6:41562811-41562833 AGGGGGATGGGGAGACAGGAGGG - Intronic
1007514374 6:42399706-42399728 ATGGGGAAGGAGAGGGAGTAGGG + Intronic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007813979 6:44507075-44507097 ATGATGATGGAGGAAGAGGAGGG + Intergenic
1007945796 6:45825881-45825903 ATGGGGATTGGACAAGAGGATGG - Intergenic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1008475515 6:51931818-51931840 AGGGGGAGAGAGAGAGAGGAGGG + Intronic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008501457 6:52187570-52187592 ATGGGAAAGGAGAGAGAGGTTGG - Intronic
1008869765 6:56259313-56259335 ATGGAGATGGAGGGAGTGGAAGG - Intronic
1009450314 6:63792182-63792204 CTGGGGATGCACCAAGAGGAGGG + Intronic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1009711043 6:67321209-67321231 ATGGGGCTGGAGAGAGAAGGAGG - Intergenic
1009715633 6:67391058-67391080 ATGATGGTGGAGAAGGAGGACGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010038034 6:71348367-71348389 ATGAGGATGGAGAGGGAGGTAGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010966376 6:82213868-82213890 GAGGGGAAGGAGAAAGAGAAGGG + Intronic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011255223 6:85413919-85413941 AAGAGAATGGAGAAAAAGGAGGG + Intergenic
1011459901 6:87592089-87592111 ATGGTGTTTGAGATAGAGGAAGG - Intronic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011798438 6:90982949-90982971 ATGGGGAAGGATGAAAAGGAGGG - Intergenic
1012213916 6:96558158-96558180 GTTGGGAGGGAGTAAGAGGATGG + Intergenic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1012546914 6:100430614-100430636 AGGGGGATGGACACAGAGGGTGG - Intronic
1012548025 6:100441405-100441427 ATGGGGATGGGATGAGAGGAAGG - Intronic
1012631274 6:101470617-101470639 CTGGGGATGGGGGAAGAGTAGGG + Intronic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013164782 6:107579936-107579958 AGGAGGATGGAGAATTAGGAGGG + Intronic
1013551476 6:111211844-111211866 CCAGGGATGGAGAAAAAGGAAGG - Intronic
1013765992 6:113574924-113574946 ATGTGGTTGCAGAAAGAGAAAGG - Intergenic
1013976276 6:116082380-116082402 ATTGGGATGGAGAGGGATGAGGG + Intergenic
1014126147 6:117779325-117779347 AGAGGGAAGGAGATAGAGGAAGG - Intergenic
1014215038 6:118745189-118745211 AGGGGGAAGGAGAAAAAAGATGG + Intergenic
1014403704 6:121022795-121022817 ATGTGGAGAGAGAAAGAGTAGGG + Intergenic
1014426884 6:121318062-121318084 AGGGGGGTGGAGAAAGAGATAGG - Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015186682 6:130425002-130425024 CTGGGGATGGAGTAAGAGGGAGG - Intronic
1015189427 6:130457067-130457089 AGGAGGAGGGAGAAAGAGAAAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017147144 6:151244627-151244649 ATGGAAATGGAGAACGAAGATGG + Intronic
1017193424 6:151676930-151676952 TTGGAGATGGAGACAGAGTATGG + Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017685730 6:156912454-156912476 AGTGGGATGGGGAAAGAGGGAGG + Intronic
1017799568 6:157881347-157881369 AAGGAGAGGGAGAAAGACGAGGG - Intronic
1017812818 6:157996455-157996477 ATGAGGGTGGAGAAAGAGGCAGG - Intronic
1017814400 6:158006308-158006330 ATGGGGAGGGAGAGAGAAAATGG - Intronic
1018092909 6:160360959-160360981 AGGGGTAGGGAGTAAGAGGAGGG + Intronic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018439987 6:163803030-163803052 CTTGGGATGGAGTGAGAGGAGGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018633368 6:165839799-165839821 ATGGGGATGGAGCTGGAGAAGGG - Intronic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1018988103 6:168653180-168653202 CTGGGCGTGGCGAAAGAGGACGG + Exonic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019158227 6:170052837-170052859 AGGGGGAGGGAGAGAGAGGGAGG - Intergenic
1019247753 6:170720474-170720496 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247768 6:170720523-170720545 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019327636 7:446116-446138 ATGGAGAGGGAGGAAGAAGAGGG + Intergenic
1019420062 7:946578-946600 ATGGGGCTGGAGCACCAGGAGGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020520937 7:9186295-9186317 ATGGGGTGGGAGAAGGAGGGAGG - Intergenic
1020685189 7:11285851-11285873 AAGGGAATAGAGAAAGAGGGAGG - Intergenic
1020743199 7:12048604-12048626 TTAAGGATGGAGAAAGAGAAAGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021402585 7:20226454-20226476 ATGAGAATGGAGAGATAGGAAGG - Intergenic
1021583067 7:22177484-22177506 ATGGGCAAGGAGAAAAAGTAAGG + Intronic
1021618007 7:22522261-22522283 GGAGGGATGGTGAAAGAGGAGGG - Intronic
1022061349 7:26799024-26799046 AAGGGGAGGGGAAAAGAGGAGGG + Intronic
1022138628 7:27472817-27472839 ATGGTGGTGTAGAAAGAGAAAGG - Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1022456103 7:30559659-30559681 ATGAGGCTGGAGAGAGAGGCAGG - Intergenic
1022529133 7:31056334-31056356 ATCAGGAGGGAGAAAGATGAGGG - Intronic
1022590210 7:31654341-31654363 ATGGAGATGGAGGGAGGGGAAGG + Intronic
1022894331 7:34734399-34734421 ATGGGAATGGAGAAACAGGCAGG + Intronic
1022988071 7:35679822-35679844 ATAGGGAAGAAGTAAGAGGAAGG - Intronic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1023583113 7:41702457-41702479 ACGGGGATGGTGAAAGAGAATGG + Intronic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1024141242 7:46465286-46465308 ATAGGCATGGAGAAATAGGAAGG + Intergenic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1024979612 7:55146342-55146364 ATGGGGAGGAAGGAAGAGAATGG - Intronic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026176519 7:68002502-68002524 ATGGAGATGGAGAGAAATGAAGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026308833 7:69166264-69166286 ATGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026760932 7:73125181-73125203 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026855276 7:73749418-73749440 ATGGGGAGGGGGAAAGATGGTGG + Intergenic
1026865510 7:73821808-73821830 ATGGGGATGGAGACTGATGCTGG + Intronic
1026882421 7:73915959-73915981 ATGGGCATAGTGAAAGAAGAGGG - Intergenic
1026951216 7:74348227-74348249 AGAGGAATGGAGAAAAAGGAGGG + Intronic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027037274 7:74933977-74933999 GCGTGGATGGAGAGAGAGGAGGG - Intergenic
1027052931 7:75031128-75031150 TTTGGCATAGAGAAAGAGGAGGG - Intronic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027086288 7:75267475-75267497 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1027281954 7:76615360-76615382 ATGGGGCTGGGGATAAAGGAGGG - Intronic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027708518 7:81567163-81567185 ATGGGGAGCGGGAAAGGGGATGG - Intergenic
1027878718 7:83803881-83803903 ATGTGGGTGGAGGAATAGGATGG + Intergenic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028332502 7:89611949-89611971 ATGGGGCTGAAGAAATAGGTTGG - Intergenic
1028374670 7:90133847-90133869 GGAGGGATGGTGAAAGAGGAGGG + Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1029069574 7:97884178-97884200 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
1029203436 7:98854374-98854396 ATGGGCATGGAGACAAAGGTTGG - Intronic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029252474 7:99246781-99246803 GTGGGCATGGAGCAAGTGGAGGG + Intergenic
1029392591 7:100285502-100285524 GCGTGGATGGAGAGAGAGGAGGG + Intergenic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1029905655 7:104090944-104090966 AGGGTGCTGGGGAAAGAGGAAGG + Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030021431 7:105278767-105278789 AGGGGAAAGGAGAAAGGGGAAGG + Intronic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030259750 7:107550645-107550667 ATGGGGATGGATGAAGGAGAGGG - Intronic
1030360144 7:108587191-108587213 ATGGGGAGGGAGTAAATGGAAGG - Intergenic
1030869084 7:114733522-114733544 ATGGGGAGGGAGGAGGAGAAGGG + Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031611028 7:123827438-123827460 GTTGGGAAGGAAAAAGAGGAAGG - Intergenic
1031873511 7:127112359-127112381 ATGCAGGTGGTGAAAGAGGAAGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032288322 7:130561708-130561730 ATTGGGATAGACAAAGAGGTGGG - Intronic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1032554126 7:132813779-132813801 CAGGTGGTGGAGAAAGAGGAGGG + Intronic
1033061136 7:138109362-138109384 ATGTGGGTGGAGAGAAAGGAGGG - Intronic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033263581 7:139865566-139865588 AGGGGGAGGGAGGAAGAAGAAGG + Intronic
1033343869 7:140512454-140512476 ATGGGGCTGGTGAGAGAGAAGGG + Intergenic
1033600434 7:142885200-142885222 GTAGGGCTGGTGAAAGAGGATGG - Intronic
1033740840 7:144274685-144274707 AAGGGGATGAGGAAAGAGGGGGG - Intergenic
1033753066 7:144374928-144374950 AAGGGGATGAGGAAAGAGGGGGG + Intronic
1033804378 7:144937556-144937578 AAGGGGAAGGAGAAAGGGAAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1034183113 7:149153986-149154008 CTGGGGGTGTAGGAAGAGGAAGG - Exonic
1034752375 7:153582886-153582908 ATGGGGATGGAACAAGATGTGGG + Intergenic
1034995100 7:155572039-155572061 AGGGGCATGGGGAGAGAGGAAGG + Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500368 8:87413-87435 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500383 8:87462-87484 AGGGGGATGGAGAGGGAGAAAGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035826602 8:2651603-2651625 CTTGGGTTGGATAAAGAGGAGGG + Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036248971 8:7145487-7145509 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
1036251819 8:7168845-7168867 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
1036365672 8:8118616-8118638 ATGAGGCTGGAGAAAGAGAGGGG + Intergenic
1036547142 8:9782802-9782824 CTAGGCATGGAGAAAGAAGAGGG - Intergenic
1036885276 8:12547488-12547510 ATGAGGCTGGAGAAAGAGAGGGG - Intergenic
1037147004 8:15584701-15584723 GTGGGGGTGGTGAAGGAGGAGGG + Intronic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1037719129 8:21427917-21427939 ATGGGAATGGAGAAGGGAGAAGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1038126202 8:24675572-24675594 AGGGGGATGAAAAGAGAGGAAGG - Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038319636 8:26514693-26514715 TTGGGGGTGGAGACGGAGGACGG + Intronic
1038390922 8:27200092-27200114 ATGGAAATGGATGAAGAGGAAGG - Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038945558 8:32355647-32355669 ACAGGGATGGAGAAAGAAGGGGG + Intronic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039504561 8:38042608-38042630 ATTTGGATGCAGACAGAGGAAGG - Intronic
1039617320 8:38966420-38966442 ATGATGCTGGAGACAGAGGAAGG + Intronic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1040894217 8:52349179-52349201 AAGGGAAGGGAGAAAGAAGAAGG - Intronic
1040951658 8:52943038-52943060 AAGGTGATGGACAAAGAGTAAGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042176518 8:66042684-66042706 AGGGGGAGGGGGAGAGAGGAGGG - Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042322750 8:67495246-67495268 ATGGGAATGGAAGAGGAGGATGG - Intronic
1042566011 8:70112772-70112794 ATGGGGAATGAGAGAGGGGAAGG + Exonic
1042626151 8:70759346-70759368 AAGGGGGTGGAGAGAAAGGAAGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043155051 8:76768480-76768502 AGGGGGAAAGAGAAAGATGAGGG + Intronic
1044029708 8:87221037-87221059 ATAAGGATGGAGAAAGAAAAGGG - Intronic
1044237343 8:89846235-89846257 AGTGGGATGGAAAAAGGGGATGG - Intergenic
1044239771 8:89875286-89875308 ATTAGGCTAGAGAAAGAGGAGGG - Intergenic
1044333644 8:90950189-90950211 GTGGGGGTGGAGAAAAAGGATGG + Intronic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044460421 8:92438160-92438182 ATGGGGGAAGAGAAAAAGGATGG - Intergenic
1044654595 8:94534574-94534596 AAGGGGAGGGAGAGAAAGGAGGG - Intronic
1044824833 8:96185901-96185923 CAGGGGATGGAGAAACAGAAGGG - Intergenic
1044928212 8:97227174-97227196 CTGGGGATGGAGATGGATGATGG - Intergenic
1045220971 8:100200088-100200110 ATGGGGTTGGAGTGAGGGGAGGG - Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045503091 8:102758160-102758182 GTGGGGGTGGAGAAAGAGGGAGG - Intergenic
1045546151 8:103130524-103130546 ATAGAGAGAGAGAAAGAGGATGG - Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045888791 8:107129818-107129840 ATAGGAAGGGGGAAAGAGGAAGG + Intergenic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046680980 8:117169737-117169759 ATGGGAATGGAGCAAGGGCAAGG + Intronic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046825070 8:118680241-118680263 ATGGTGCTGGAGAAATTGGATGG - Intergenic
1046832893 8:118765748-118765770 ATTGAGTTGGAGAAAGAAGAGGG + Intergenic
1046890164 8:119414137-119414159 ATTGGGATCTAGAGAGAGGAGGG - Intergenic
1047455204 8:125002135-125002157 ATCAGGATGGGGAAAAAGGAGGG + Intronic
1047556738 8:125940215-125940237 AGGGGGCTGGAGAAAGAGAGAGG - Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047818763 8:128495160-128495182 ATGAGGATTGAGGAAGAGGATGG - Intergenic
1047891717 8:129319137-129319159 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1047969666 8:130073720-130073742 AGAGGGATGGAAAGAGAGGATGG + Intronic
1048480838 8:134791211-134791233 TTTAGGGTGGAGAAAGAGGAAGG - Intergenic
1048792013 8:138112836-138112858 GTGGGGGTGGAGACAGGGGAAGG + Intergenic
1048990695 8:139758537-139758559 ATGGGGATGCAGACACAGGGAGG + Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049201209 8:141341492-141341514 GTGGGGGTGGGGGAAGAGGAGGG + Intergenic
1049288380 8:141788821-141788843 ATTTGGATGTAGGAAGAGGAGGG - Intergenic
1049315824 8:141966818-141966840 GTGGGGATGGAGGAAGGGGATGG + Intergenic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049794893 8:144492749-144492771 AGGAGGGTGCAGAAAGAGGATGG - Intronic
1050051646 9:1608307-1608329 GTGAGGATTGAGAAAGGGGAGGG + Intergenic
1050321175 9:4453847-4453869 ATGGGGTGGGAGGAAGGGGAGGG + Intergenic
1050459649 9:5866773-5866795 GTGGGGATGGGCAAAGAGCAAGG + Intergenic
1050475928 9:6041041-6041063 AGAAGGAAGGAGAAAGAGGAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050609077 9:7332415-7332437 TGGGGTATGGAGAAAGAGTATGG + Intergenic
1050772807 9:9224308-9224330 ATGGGGAGGGAGAAAGGGAAAGG + Intronic
1050846817 9:10231531-10231553 ATGGGGGTGGAGATGGAGGTGGG + Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051109988 9:13624920-13624942 AAAGTGATGAAGAAAGAGGAGGG + Intergenic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1052164271 9:25304311-25304333 ATGGGGAAGGAGAGAGGGAAGGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052340670 9:27361409-27361431 AAGGGGATGGGGACAGAAGAAGG + Intronic
1052363510 9:27586007-27586029 GTGGGGATGGTGGTAGAGGAGGG - Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1052821184 9:33138922-33138944 TTGGGGTTGGGGAGAGAGGAGGG - Intronic
1052876939 9:33574557-33574579 CTAGGGATGCAGACAGAGGAGGG - Intergenic
1053113574 9:35482539-35482561 ATGGGGAAGGGAAAAGAAGATGG + Intergenic
1053143878 9:35698996-35699018 ATGGTGAGGGTGGAAGAGGAAGG + Intronic
1053198674 9:36138103-36138125 ATGGTGATGGAGCAAAAGTATGG + Intronic
1053350719 9:37411762-37411784 AAGGGGATGGAGGCAGGGGATGG - Intergenic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054747320 9:68867757-68867779 ATGGGGATGAAGAAAGGGGTAGG + Intronic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1054924142 9:70571948-70571970 ATGGACATGGAGAAAAAGAAGGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055101678 9:72472028-72472050 ATGGGGATGGATGAGGATGAGGG + Intergenic
1055166329 9:73199736-73199758 AAGGAGATGGGGAAAGAGGGAGG + Intergenic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1055677775 9:78682798-78682820 AAGGGGAGGAAGAGAGAGGAAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056539597 9:87559900-87559922 AAGCGGATGGAGGCAGAGGAAGG - Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056834658 9:89944683-89944705 AGGGGGGTGGAGGGAGAGGAAGG + Intergenic
1057055135 9:91954588-91954610 ATGGTGATAGAGAGAGAGGACGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057713972 9:97474056-97474078 ATGGGTAAGGAGGAAGATGAAGG - Intronic
1057875973 9:98754803-98754825 ATTGGGATGAAAAAAGAAGAGGG - Intronic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058274738 9:103025310-103025332 ATGGTGATTGAGAAAGTGAAAGG - Intergenic
1058721575 9:107769206-107769228 AGGGGGATTGAGAATGAGAAAGG - Intergenic
1058750357 9:108033244-108033266 ATGAGGATGGAGAAAGTGGTGGG - Intergenic
1058985830 9:110207728-110207750 AGGGGGAAGGAGAAAGATGAAGG + Exonic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059296275 9:113274066-113274088 ATGGGAATGGAAAAACAGCACGG - Intronic
1059354261 9:113687179-113687201 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1060016179 9:120088273-120088295 CTGAGGATGGAGAAAAGGGAAGG + Intergenic
1060044110 9:120326374-120326396 ATGAGGCTGGAGACAGAGGTTGG - Intergenic
1060259990 9:122066027-122066049 ATGGGGGTGGAGTAGAAGGAGGG + Intronic
1060297759 9:122354932-122354954 CTGGGGATAGACAGAGAGGAGGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060819027 9:126651108-126651130 ATGGGGAGGGAGAGAGGGGCAGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061021840 9:128020773-128020795 AGGGGGAAGGAGAAACAGAAAGG - Intergenic
1061269883 9:129533394-129533416 ATGGGGTTGGAAAAACTGGATGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061634856 9:131901078-131901100 ATGGGGAGAGAGAATGAGGGAGG + Intronic
1061783228 9:133007975-133007997 AAGAGGAGGGAGAGAGAGGAGGG - Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1061920426 9:133779577-133779599 AAGGGGATGGAGAACGTGGTGGG + Intronic
1061942527 9:133891351-133891373 AGGGGGAGGGATAAAGGGGAGGG + Intronic
1061942561 9:133891432-133891454 AAGGGGAGGGATGAAGAGGAGGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062190918 9:135247434-135247456 AGGGGAGTGGAGGAAGAGGAGGG + Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638417 9:137503611-137503633 AGGAGGAGGGAGAAGGAGGAGGG + Intronic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1203608524 Un_KI270748v1:75954-75976 AGGGGGATGGAGAGGGAGAAAGG + Intergenic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1185490946 X:516588-516610 ATTGGGATGCAGTGAGAGGAGGG - Intergenic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185662002 X:1735487-1735509 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1186017836 X:5218111-5218133 AAAGGGAAGGATAAAGAGGAAGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186102051 X:6167687-6167709 ATGGGGATGGAGAAGAAGCAGGG - Intronic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186301482 X:8204525-8204547 ATGGGAATAGTGAAATAGGAAGG - Intergenic
1186403744 X:9283443-9283465 GGGAGGATGGAGGAAGAGGAAGG - Intergenic
1186478300 X:9876479-9876501 CTAGGAATGGAGAAAGAGGAGGG - Intronic
1186679618 X:11858066-11858088 AAGGTGGTGGAGAAAAAGGAAGG + Intergenic
1186772415 X:12830967-12830989 TTGGGGGTGGAGAAACGGGAGGG + Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187025792 X:15434140-15434162 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025806 X:15434240-15434262 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025823 X:15434347-15434369 AGGGGGAAGGAGAAAGAAGGAGG + Intronic
1187097710 X:16164985-16165007 AGAGGGGTGGAGGAAGAGGAAGG - Intergenic
1187371938 X:18716592-18716614 ATGGGGATGGAGAGCCGGGAGGG - Intronic
1187460057 X:19478193-19478215 AGGGGGAGAGAGAAAGAGGGAGG + Intronic
1187737005 X:22314998-22315020 AGAGGGAGGGAGAAAGAAGAGGG - Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188361065 X:29254467-29254489 AGGGGGAGGGAGAGAGAGGGAGG + Intronic
1188532827 X:31161639-31161661 AAGGGGATGGAGAAATTAGAAGG - Intronic
1188647524 X:32589113-32589135 ATTGTGATGGTGAAAAAGGAAGG - Intronic
1188876855 X:35441060-35441082 AAGGGGAAGGAGAAATAGGGTGG + Intergenic
1189294113 X:39906929-39906951 TTGGGGATGGAGAGACAGAATGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1190988729 X:55523601-55523623 ATGGGGATGGAGAGGCAGAAAGG + Intergenic
1191641787 X:63434354-63434376 AGGGGGAAGGAGAAAGCGGTGGG + Intergenic
1191880639 X:65841205-65841227 ATGGGTATGAGGGAAGAGGATGG + Intergenic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1192587626 X:72331930-72331952 TTAGGGATGGTGAAGGAGGAGGG - Intronic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1193144602 X:78064072-78064094 AGGGGGATGGAGCAGGAAGAAGG + Intergenic
1193225167 X:78974100-78974122 ATGGGGTTGGAGAAAGGGGGAGG - Intergenic
1193315319 X:80058146-80058168 AAGGGAAGGGAGAAAAAGGAAGG + Intergenic
1193380367 X:80809900-80809922 AAGGGGGTGGAGAGAGGGGAGGG + Intergenic
1193426777 X:81349126-81349148 ATGGGGTTACAGGAAGAGGAGGG - Intergenic
1193695141 X:84699430-84699452 AGGGGGTGGGAGAAAGGGGAGGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195513317 X:105742892-105742914 ATGGTGATGGAGATGGAGAAGGG - Intronic
1195696221 X:107669589-107669611 AGGGGGATGGGGGAGGAGGAAGG - Intergenic
1195701662 X:107710252-107710274 CTGGGGATGGCCACAGAGGAGGG - Intergenic
1196051844 X:111313894-111313916 AGGGGGAGGGAGAAAGAGTGGGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196143900 X:112296150-112296172 ATGAGGTTGGATAGAGAGGAAGG - Intergenic
1196331607 X:114476791-114476813 ATGGGGAGGGAAAAATAGAATGG + Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1196568319 X:117235025-117235047 GTGGGAGTGGGGAAAGAGGAAGG - Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1196991655 X:121335827-121335849 ATGGGGATGGCCTCAGAGGAAGG - Intergenic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197106311 X:122720701-122720723 AGGGAGATGGGGAGAGAGGAGGG + Intergenic
1197566917 X:128099576-128099598 AGGGGGCTGGGGAAAGGGGAGGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198058234 X:133016754-133016776 ATGGTGGTTGAGAAAGAGGGTGG + Intergenic
1198082997 X:133256659-133256681 AAGGGTCTGGATAAAGAGGAGGG + Intergenic
1198738738 X:139817469-139817491 ATGGGGCTGGAGAGGGAGGCAGG + Intronic
1198958859 X:142162284-142162306 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1198961361 X:142186688-142186710 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199871795 X:151904822-151904844 ATTGGTTTGGGGAAAGAGGATGG + Intergenic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1201253838 Y:12088001-12088023 ACGGTGAGAGAGAAAGAGGAAGG - Intergenic
1201255117 Y:12099819-12099841 TTGTGGATGGAGACAGTGGAGGG + Intergenic
1201302795 Y:12524658-12524680 CTAGGAATGGAGAAAGAGAAGGG - Intergenic
1201683497 Y:16675788-16675810 CTGAGAATGGAGAAAGAGAATGG + Intergenic