ID: 951604836

View in Genome Browser
Species Human (GRCh38)
Location 3:24421595-24421617
Sequence GTCCTGGGTGGCACGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951604836_951604848 21 Left 951604836 3:24421595-24421617 CCACAGGACGTGCCACCCAGGAC 0: 1
1: 0
2: 5
3: 19
4: 169
Right 951604848 3:24421639-24421661 AGAGAGAAAAGCATGCAAAATGG 0: 1
1: 3
2: 10
3: 147
4: 1234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951604836 Original CRISPR GTCCTGGGTGGCACGTCCTG TGG (reversed) Intronic
900894021 1:5470367-5470389 GCCCTGGGTGGCATGTGCTAGGG + Intergenic
901053912 1:6440039-6440061 GTGCTGGGTGGGACGCCCTCAGG + Intronic
901212521 1:7534601-7534623 GTCCTCGGCGGCACGGGCTGTGG + Intronic
901628109 1:10634964-10634986 GGCCTGGGTGCAGCGTCCTGAGG + Intergenic
901734353 1:11302964-11302986 GTCCTGGGAGGGAGGACCTGAGG + Intergenic
901741103 1:11342555-11342577 GTCCTGGGGGGCCTTTCCTGGGG + Intergenic
902480382 1:16708271-16708293 GTGCTGGGTGGGACGCCCTCAGG - Intergenic
903535408 1:24063314-24063336 GCCCTGGGGGGCAGGTGCTGTGG + Intronic
908473785 1:64470014-64470036 GTCCCGGGGGGCAGGTTCTGAGG + Intergenic
910178319 1:84454795-84454817 GTCCTGGGTGGTGCAGCCTGAGG + Intergenic
913052985 1:115133250-115133272 GTCCTAGATGGCAAGCCCTGAGG + Intergenic
916674593 1:167054788-167054810 GGACTGGGAGGCAGGTCCTGGGG + Intronic
919545061 1:198905575-198905597 GTCCTGGGTGGCAAGGGCAGCGG + Intergenic
919984171 1:202661311-202661333 CTACTGGGTGGCACCTACTGGGG + Intronic
922109880 1:222546701-222546723 CACCTGGGTGGCACCGCCTGGGG - Intronic
1064996817 10:21303324-21303346 CTCCTGGGTGGCAATCCCTGAGG - Intergenic
1067136582 10:43613809-43613831 GTCCTGGCTAGCACTTCCTGTGG + Intronic
1067684613 10:48458972-48458994 GTCCTGGTGGGCCCATCCTGGGG + Intronic
1069549590 10:69353701-69353723 TTCCTGGGTGGCACATCTGGAGG + Intronic
1070547676 10:77465377-77465399 CTCCAGGATGGCACCTCCTGGGG + Intronic
1070630751 10:78082700-78082722 GCCCTGGGAAGCAAGTCCTGGGG - Intergenic
1073038309 10:100579780-100579802 GTGCTGGCTGGCACCTCCTCAGG - Intergenic
1074143339 10:110696283-110696305 GTCCTGGGTAAGAAGTCCTGGGG - Intronic
1074157426 10:110811121-110811143 CACCTGGCTGGCACGTCCTGGGG + Intronic
1077383330 11:2257535-2257557 GCCCAGGGTGGCACGTGCTGCGG - Intergenic
1077408361 11:2392552-2392574 GTCGGGGGTGGCAGGTCCTGTGG - Intronic
1077488658 11:2850556-2850578 CTGGTGTGTGGCACGTCCTGCGG + Intergenic
1079766173 11:24395984-24396006 CTCATGGGTGGCACCTTCTGTGG + Intergenic
1081992940 11:47347399-47347421 GTCCTGGGTGGCAGTTCCTGGGG - Intronic
1082810712 11:57477290-57477312 GTCCTGGGTGGGGCTCCCTGGGG - Exonic
1083302535 11:61746471-61746493 GTCCCTGATGGCTCGTCCTGGGG - Exonic
1084087701 11:66862118-66862140 GTCCTGGCGGGGATGTCCTGCGG - Intronic
1084238892 11:67805581-67805603 GTTCTGGTTGGCGGGTCCTGGGG + Intergenic
1085929583 11:81065243-81065265 ATCCTGGGTGTCCTGTCCTGAGG - Intergenic
1088532967 11:110830541-110830563 ATCCTGGCTGTCACCTCCTGGGG + Intergenic
1089788336 11:120923987-120924009 GTGATGGCTGGCAAGTCCTGGGG + Intronic
1091311852 11:134580506-134580528 GTCCAGGGTGGCAGGTTCAGAGG + Intergenic
1103340591 12:120219288-120219310 GTCCTGGGTGGCAGCTTCCGTGG + Intronic
1103847424 12:123911289-123911311 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847438 12:123911319-123911341 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847525 12:123911515-123911537 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847567 12:123911607-123911629 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847581 12:123911637-123911659 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847604 12:123911684-123911706 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847618 12:123911714-123911736 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847653 12:123911790-123911812 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847668 12:123911821-123911843 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847720 12:123911941-123911963 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847754 12:123912015-123912037 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847783 12:123912076-123912098 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847829 12:123912169-123912191 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847947 12:123912442-123912464 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1103847953 12:123912456-123912478 GTCCTGGGGGGTCTGTCCTGGGG + Intronic
1104064752 12:125297395-125297417 GCCCTGTGTGGAGCGTCCTGGGG + Intronic
1106571997 13:30935259-30935281 GTCCTGGGTGGAAGGGGCTGGGG + Intronic
1106901976 13:34363305-34363327 GTTTTGTGTGGCACGCCCTGGGG - Intergenic
1107875861 13:44790005-44790027 GTCCTGGGTGGAAGGGGCTGGGG - Intergenic
1113505579 13:110813573-110813595 GTCCTGAGGGGGACGTCGTGAGG - Intergenic
1113854276 13:113435382-113435404 CACCTGGGTGCCAGGTCCTGGGG - Intronic
1118753413 14:68822254-68822276 GTCCTTGGTGGCACTTTCAGTGG - Intergenic
1119189564 14:72671274-72671296 GTCCTCCGTGGTACGTGCTGCGG + Exonic
1121110097 14:91306887-91306909 GTCTTGAGTTGCAGGTCCTGTGG - Intronic
1123034790 14:105467494-105467516 GTCCTGGCAGGCACGTCCTGTGG + Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123905286 15:24914707-24914729 GTCCTGGGTGAGAGGTCCAGGGG + Intronic
1129909182 15:79212155-79212177 GTCCTGGGTGACAGGTCTTAGGG + Intergenic
1130980174 15:88807099-88807121 GCCCTAGGTGGCAGGTGCTGGGG + Intronic
1132672517 16:1107638-1107660 GGCCTGGGGGGCACGGCCTGAGG + Intergenic
1132936309 16:2483078-2483100 GTCCTGGCTCTCACCTCCTGGGG - Intronic
1133350559 16:5097995-5098017 GTCCAGGTTGGCGGGTCCTGGGG + Intergenic
1134330899 16:13250320-13250342 GTCCTGAGTGGGCAGTCCTGAGG + Intergenic
1136317693 16:29463917-29463939 GCCCTGGGTGGCACACCCTTTGG - Intronic
1136432268 16:30203262-30203284 GCCCTGGGTGGCACACCCTTTGG - Intronic
1137543728 16:49383199-49383221 GTCCTGGGTGCCACATCTTGAGG - Intronic
1137750293 16:50856645-50856667 GTTATGGGTTGGACGTCCTGTGG + Intergenic
1137863263 16:51868166-51868188 CTCCTGGGAAGCACCTCCTGAGG + Intergenic
1139515474 16:67450084-67450106 GTCCTGGGTGTGAAGACCTGAGG - Intronic
1139589941 16:67927998-67928020 GTGCTGGGTGGAGTGTCCTGTGG + Exonic
1140829448 16:78737834-78737856 GTCCTGGGTGGTTTGTCCTTGGG + Intronic
1141432775 16:83979438-83979460 GTCCTGGGGGGCACTGGCTGGGG + Intronic
1141988966 16:87599350-87599372 CTCCTTGTTGGCACGTCCAGGGG + Intergenic
1142053309 16:87974813-87974835 GCCCCGGGTGGCTCGTCCAGTGG + Intronic
1142667624 17:1471694-1471716 CTCCTGGAGGGCACGGCCTGGGG + Intronic
1143118482 17:4593486-4593508 GTCCTCCGTGGTATGTCCTGGGG + Intronic
1143409980 17:6702943-6702965 GTCCTTGGTCGCACCTTCTGGGG - Intronic
1147794132 17:43030594-43030616 GTCCTGTGAGCCAGGTCCTGAGG + Intergenic
1148052984 17:44778214-44778236 GTCCTGGGCGGCACGGGCTGGGG + Exonic
1148800304 17:50220989-50221011 GTCCTGAGCGGCAGGGCCTGGGG - Intergenic
1149289825 17:55207210-55207232 GCCCGGGATGGCACATCCTGGGG - Intergenic
1150007785 17:61480244-61480266 GTGCTGAGGGGCAGGTCCTGCGG - Exonic
1150452215 17:65278632-65278654 GAGCTGGGTGGCACAGCCTGAGG - Intergenic
1152069122 17:78126446-78126468 GAGCTGGGAGGCCCGTCCTGAGG + Intronic
1160748055 19:720643-720665 GGCCAGGGGGGCGCGTCCTGGGG + Intronic
1160835230 19:1121873-1121895 GTCCTGGGAGGCTGGCCCTGTGG - Intronic
1160977404 19:1800069-1800091 GCCTTGGCAGGCACGTCCTGCGG + Exonic
1161479985 19:4505623-4505645 GGCGTGGGTGCCACGTGCTGGGG - Intronic
1162838764 19:13340278-13340300 GTGCTGGGTAGCATGTCCTGTGG - Intronic
1163648152 19:18501940-18501962 GGCCTGGCGGGCAGGTCCTGGGG + Intronic
1165172934 19:33906329-33906351 GGCCTAGGGGGCGCGTCCTGTGG - Intergenic
1166293748 19:41878990-41879012 GCCCTGGGTGCCAGGCCCTGTGG + Exonic
1167717898 19:51155676-51155698 GTCCTGGGTACCACCTCATGAGG + Intergenic
1168184938 19:54694539-54694561 GTCGTTGGTGGCACTTCTTGTGG + Intronic
1202714423 1_KI270714v1_random:34173-34195 GTGCTGGGTGGGACGCCCTCAGG - Intergenic
925702217 2:6650206-6650228 GTTCTGGGTGGCAAAGCCTGTGG - Intergenic
925977122 2:9149415-9149437 GTCCTGGGTTGCTCTTCCCGAGG - Intergenic
929594597 2:43168357-43168379 GTCCTGGGTGGGACTTTCTGGGG + Intergenic
932751192 2:74372758-74372780 GTGCTGGCAGGCACCTCCTGGGG - Intronic
933918697 2:87022828-87022850 GTCTTGGGTGGAACGTCCTGTGG + Intergenic
934004298 2:87747087-87747109 GTCTTGGGTGGAACATCCTGTGG - Intergenic
935767258 2:106381101-106381123 GTCTTGGGTGGAACGTCCTGCGG - Intergenic
938047893 2:128139688-128139710 ATCCCGGGTGGCACCTGCTGTGG + Intronic
938083783 2:128385056-128385078 GTCCTGGGCGGGAGGTACTGTGG + Intergenic
939092840 2:137799317-137799339 ATGCTGGGTGCCATGTCCTGAGG - Intergenic
942492367 2:176502385-176502407 GTCCTGGTTGGCATTTTCTGAGG + Intergenic
942743231 2:179203351-179203373 GTCATGGGTGGTACTGCCTGGGG - Intronic
947716424 2:232341296-232341318 GCCCTGGGTGGGACGTCCCGGGG - Intronic
947878681 2:233485954-233485976 GTCCTCAGCAGCACGTCCTGGGG + Exonic
948451818 2:238080464-238080486 TTCCTGGGAGACACCTCCTGGGG - Intronic
948510625 2:238461870-238461892 GTACTGGGTGTCTCGTACTGTGG - Intergenic
948527553 2:238580920-238580942 TTCCTGGCTGGCCTGTCCTGTGG - Intergenic
1170568690 20:17620962-17620984 GTCCTGGGAGGGAGGTCCTCTGG + Intronic
1172025083 20:31943047-31943069 GGCCTGGGTGGCACCTGCTAAGG - Exonic
1172482481 20:35278980-35279002 GTGCTGGCTGGCAGGCCCTGTGG - Exonic
1173537851 20:43829568-43829590 GTCCTGGGTGGCGTGTGATGTGG + Intergenic
1173819544 20:46011568-46011590 GTCCTGGGTGTAGAGTCCTGGGG - Exonic
1174504461 20:51008242-51008264 GTCCTACATGGCACCTCCTGGGG - Intronic
1175141209 20:56861451-56861473 GCCCTGGATGGCACGCCCCGGGG - Intergenic
1175790772 20:61738599-61738621 TTCCTCGGAGGCACGGCCTGGGG + Intronic
1175859229 20:62141336-62141358 GTCCTGGGGGGTACGTACTCCGG + Intronic
1177369159 21:20179675-20179697 GCCCTGGGCAGCAAGTCCTGAGG + Intergenic
1178493230 21:33067583-33067605 CTCCTGGGTGCCCCTTCCTGTGG + Intergenic
1180715896 22:17872058-17872080 GGCCTGTGTGGCACTCCCTGAGG - Intronic
1180924460 22:19544243-19544265 GACCTGGGTGCCAAGTCCTGAGG - Intergenic
1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG + Intronic
1184914676 22:47561419-47561441 TTCCTGGGTGCCCCCTCCTGTGG - Intergenic
1185420961 22:50734186-50734208 GTCCTGGGTGGCACCTGGTGGGG + Intergenic
951604836 3:24421595-24421617 GTCCTGGGTGGCACGTCCTGTGG - Intronic
952929486 3:38347964-38347986 GTCCTTGGGGGAACGTCCTGTGG + Intronic
953451428 3:43009743-43009765 GTTCTGGGTGCCACCACCTGAGG - Intronic
954258462 3:49422255-49422277 GTCCTGCGGAGCACCTCCTGTGG + Exonic
955219500 3:57011969-57011991 GTCCTGGGTGGTCCTTGCTGAGG + Intronic
955548438 3:60057076-60057098 GTCCTGGGTGGAACTTCTGGGGG + Intronic
957054831 3:75435342-75435364 GTCCAGGTTGGCGGGTCCTGGGG + Intergenic
958465984 3:94459295-94459317 CTCCTGGGAGGCACATCCAGGGG - Intergenic
968891622 4:3372338-3372360 GTCCTGGGTGGGACTTTCCGGGG + Intronic
975667981 4:76753036-76753058 GTACTTGGTGGCAGGTACTGGGG + Intronic
980523206 4:133957879-133957901 ATGCTGGGTGCCATGTCCTGAGG + Intergenic
985639523 5:1057196-1057218 GACCTGGGTGCCAAGTGCTGAGG - Intronic
997357355 5:133271867-133271889 GTGCTGGGTGGCATGGCCAGTGG + Intronic
998511822 5:142720225-142720247 TTCCTGGGAGAAACGTCCTGGGG + Intergenic
999430268 5:151519897-151519919 CTCCTGGGTGTCACCTCCAGAGG - Intronic
999436293 5:151566107-151566129 GTCCCGGGGGGCAGGTCCTCTGG + Exonic
1001313360 5:170626641-170626663 GACCTGGGGGCCAGGTCCTGGGG - Intronic
1003050261 6:2774261-2774283 GTCCTTGGATGCACTTCCTGTGG + Intronic
1003506509 6:6744779-6744801 GTTCTGCGTGGCCCGTGCTGTGG - Intergenic
1004424588 6:15498681-15498703 GTCCTGGCAGGCACCTGCTGAGG - Intronic
1006363020 6:33597996-33598018 GACCTGGGTGGAAGGGCCTGGGG - Intergenic
1013226595 6:108123427-108123449 AGCCGGGGTGGCACGCCCTGGGG - Intronic
1013282523 6:108652161-108652183 TTCCTTGGTGGCACGTCTGGAGG - Intronic
1017726782 6:157281773-157281795 GTCCAAGGTGGCACTTCCTAGGG + Intergenic
1018128083 6:160701233-160701255 GTCTTGGGTGGAATGTCCTGCGG - Intergenic
1018148365 6:160915138-160915160 GTCTTGGGTGGAACGTCCTGCGG + Intergenic
1019106059 6:169667935-169667957 TTCCCGCGTGGCACGTGCTGTGG - Intronic
1019852079 7:3569657-3569679 GTCATGGCTGCCACTTCCTGAGG - Intronic
1021222096 7:17986141-17986163 GTGTTGGGGGGCACGTGCTGCGG - Intergenic
1023176838 7:37443835-37443857 GTCCTGGGAGCCACACCCTGTGG + Intronic
1023467617 7:40474490-40474512 GTGCTGGATGGCACCTCCAGGGG - Intronic
1023879965 7:44312726-44312748 GTCCTGGGTTGGATGTCATGTGG + Intronic
1026437606 7:70413406-70413428 GACCTGGGTGAAAAGTCCTGGGG + Intronic
1026890244 7:73977509-73977531 GTCCTGGGTGCCATGTCCTTGGG - Intergenic
1027437939 7:78185652-78185674 GTCCTGGGTGGCACTTGTTCTGG + Exonic
1034571462 7:151959781-151959803 GTACTGGGGGGAAGGTCCTGAGG + Intronic
1035326041 7:158066783-158066805 GTCCTTTGTGTCACATCCTGAGG - Intronic
1036379606 8:8228312-8228334 GTCCAGGTTGGCGGGTCCTGGGG - Intergenic
1041044330 8:53877377-53877399 GTCCTGGGCGGCACCTGCGGGGG - Intronic
1041632104 8:60099773-60099795 GTGCAGGGTGCCATGTCCTGAGG + Intergenic
1043060144 8:75489878-75489900 GTTCTGTGTGGAACTTCCTGTGG + Intronic
1045475779 8:102550999-102551021 GTCCTCGGGGGCCTGTCCTGGGG - Intergenic
1049287600 8:141784500-141784522 ACCCTGGGAGGCCCGTCCTGGGG + Intergenic
1049410815 8:142473266-142473288 GGTCAGGGTGGCACGTCCTGCGG - Intronic
1049674293 8:143882904-143882926 GTCCTGGGCGGCCTGGCCTGGGG + Intergenic
1049742487 8:144247769-144247791 GCCATGGGTGGCACTTCCAGAGG - Intronic
1054805868 9:69395568-69395590 GTCCTGTGTGATAGGTCCTGGGG + Intergenic
1056776376 9:89516085-89516107 GTTCTGGGTGGCCTGGCCTGGGG + Intergenic
1057195602 9:93114415-93114437 GTCCTAGGTGGCCCCACCTGAGG + Intergenic
1057329928 9:94104802-94104824 GTCCTGGTTGGCAAATCCTAAGG + Intronic
1057578248 9:96261550-96261572 GTGCTGGGTGGCAGGGCCTGAGG + Intronic
1058908480 9:109499656-109499678 GGCCTGGGTGCCAGGTCCTGGGG + Intergenic
1059437557 9:114285709-114285731 GTACTGAGTGGCACCTTCTGTGG - Intronic
1059734405 9:117087002-117087024 GTTCTGAGTAGCAGGTCCTGGGG + Intronic
1060275175 9:122177065-122177087 GATCTGGGTTGCAGGTCCTGGGG - Intronic
1062336968 9:136075600-136075622 GTTCGGGGTCGCAGGTCCTGCGG + Intronic
1062612834 9:137382760-137382782 GTCCTGAGTGCCGCGTCCTCTGG - Intronic
1062710538 9:137972893-137972915 CTCCTGACTGACACGTCCTGGGG + Intronic